\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216764706:

Variant ID: vg0216764706 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16764706
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CGAGCTCTCGTGTTGTGCATATTTGGTTTGATAGGCAGTGGGCATACTCGCATACTCGCATACGTAGTAGCCGCATAAGTTAGTTCCCTGGTCCTGCTTT[G/A]
CACACTACATGAGAAACGATGAGAGATTTAATATACTCTTTATATTAACTGTAATTAGAGATTCAATTCAATATAATTTTGGATCATGCATGTACTCACT

Reverse complement sequence

AGTGAGTACATGCATGATCCAAAATTATATTGAATTGAATCTCTAATTACAGTTAATATAAAGAGTATATTAAATCTCTCATCGTTTCTCATGTAGTGTG[C/T]
AAAGCAGGACCAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATGCACAACACGAGAGCTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 33.20% 9.84% 0.66% NA
All Indica  2759 35.10% 48.30% 15.51% 1.12% NA
All Japonica  1512 98.50% 1.30% 0.20% 0.00% NA
Aus  269 51.70% 38.70% 9.67% 0.00% NA
Indica I  595 39.50% 36.60% 22.52% 1.34% NA
Indica II  465 23.00% 50.10% 24.30% 2.58% NA
Indica III  913 40.90% 53.60% 5.37% 0.22% NA
Indica Intermediate  786 32.20% 49.90% 16.79% 1.15% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 96.70% 2.50% 0.83% 0.00% NA
VI/Aromatic  96 6.20% 91.70% 2.08% 0.00% NA
Intermediate  90 63.30% 30.00% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216764706 G -> A LOC_Os02g28350.1 downstream_gene_variant ; 4261.0bp to feature; MODIFIER silent_mutation Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0216764706 G -> A LOC_Os02g28360.1 downstream_gene_variant ; 2029.0bp to feature; MODIFIER silent_mutation Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0216764706 G -> A LOC_Os02g28370.1 downstream_gene_variant ; 1182.0bp to feature; MODIFIER silent_mutation Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0216764706 G -> A LOC_Os02g28360-LOC_Os02g28370 intergenic_region ; MODIFIER silent_mutation Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0216764706 G -> DEL N N silent_mutation Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216764706 NA 2.21E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706 7.02E-07 1.03E-08 mr1317 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706 NA 4.34E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706 NA 9.54E-11 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706 1.92E-06 7.21E-08 mr1317_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706 NA 7.00E-12 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706 NA 7.37E-11 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706 NA 2.51E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706 NA 2.44E-07 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706 NA 1.08E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216764706 NA 6.25E-07 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251