\
| Variant ID: vg0216764706 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16764706 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 99. )
CGAGCTCTCGTGTTGTGCATATTTGGTTTGATAGGCAGTGGGCATACTCGCATACTCGCATACGTAGTAGCCGCATAAGTTAGTTCCCTGGTCCTGCTTT[G/A]
CACACTACATGAGAAACGATGAGAGATTTAATATACTCTTTATATTAACTGTAATTAGAGATTCAATTCAATATAATTTTGGATCATGCATGTACTCACT
AGTGAGTACATGCATGATCCAAAATTATATTGAATTGAATCTCTAATTACAGTTAATATAAAGAGTATATTAAATCTCTCATCGTTTCTCATGTAGTGTG[C/T]
AAAGCAGGACCAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATGCACAACACGAGAGCTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.30% | 33.20% | 9.84% | 0.66% | NA |
| All Indica | 2759 | 35.10% | 48.30% | 15.51% | 1.12% | NA |
| All Japonica | 1512 | 98.50% | 1.30% | 0.20% | 0.00% | NA |
| Aus | 269 | 51.70% | 38.70% | 9.67% | 0.00% | NA |
| Indica I | 595 | 39.50% | 36.60% | 22.52% | 1.34% | NA |
| Indica II | 465 | 23.00% | 50.10% | 24.30% | 2.58% | NA |
| Indica III | 913 | 40.90% | 53.60% | 5.37% | 0.22% | NA |
| Indica Intermediate | 786 | 32.20% | 49.90% | 16.79% | 1.15% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 91.70% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 30.00% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216764706 | G -> A | LOC_Os02g28350.1 | downstream_gene_variant ; 4261.0bp to feature; MODIFIER | silent_mutation | Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0216764706 | G -> A | LOC_Os02g28360.1 | downstream_gene_variant ; 2029.0bp to feature; MODIFIER | silent_mutation | Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0216764706 | G -> A | LOC_Os02g28370.1 | downstream_gene_variant ; 1182.0bp to feature; MODIFIER | silent_mutation | Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0216764706 | G -> A | LOC_Os02g28360-LOC_Os02g28370 | intergenic_region ; MODIFIER | silent_mutation | Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0216764706 | G -> DEL | N | N | silent_mutation | Average:26.838; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216764706 | NA | 2.21E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216764706 | 7.02E-07 | 1.03E-08 | mr1317 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216764706 | NA | 4.34E-07 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216764706 | NA | 9.54E-11 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216764706 | 1.92E-06 | 7.21E-08 | mr1317_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216764706 | NA | 7.00E-12 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216764706 | NA | 7.37E-11 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216764706 | NA | 2.51E-06 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216764706 | NA | 2.44E-07 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216764706 | NA | 1.08E-06 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216764706 | NA | 6.25E-07 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |