\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216763017:

Variant ID: vg0216763017 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 16763017
Reference Allele: TAlternative Allele: C,TGTCACGCCCGGAATTTCTATCCAAAAATTCCAAAC,TGTCACGCCCG,TGTCAC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.27, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCCCCAACCCAAAAAAGCCTCTTTCTCTCCTATTCCTCTCTTTCCTATTCTACCCCTCTCTTCCCCTTCTCTCTCTCTCTTTCTCCATCGCACGCACG[T/C,TGTCACGCCCGGAATTTCTATCCAAAAATTCCAAAC,TGTCACGCCCG,TGTCAC]
GAGAGTGCCGTCGCCACTCTCTCTCCCGCCGCTCTCTCCCTCTCTCTCTCCCGTGATGGTGGTGGCGGCGACCCCGGAGGCGGCAGATCCGGCGCTGCCG

Reverse complement sequence

CGGCAGCGCCGGATCTGCCGCCTCCGGGGTCGCCGCCACCACCATCACGGGAGAGAGAGAGGGAGAGAGCGGCGGGAGAGAGAGTGGCGACGGCACTCTC[A/G,GTTTGGAATTTTTGGATAGAAATTCCGGGCGTGACA,CGGGCGTGACA,GTGACA]
CGTGCGTGCGATGGAGAAAGAGAGAGAGAGAAGGGGAAGAGAGGGGTAGAATAGGAAAGAGAGGAATAGGAGAGAAAGAGGCTTTTTTGGGTTGGGGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 27.30% 6.47% 5.40% TGTCACGCCCGGAATTTCTATCCAAAAATTCCAAAC: 0.66%; TGTCACGCCCG: 0.51%; TGTCAC: 0.17%
All Indica  2759 77.40% 5.10% 8.30% 7.58% TGTCACGCCCG: 0.72%; TGTCACGCCCGGAATTTCTATCCAAAAATTCCAAAC: 0.65%; TGTCAC: 0.22%
All Japonica  1512 25.90% 73.80% 0.13% 0.13% TGTCACGCCCG: 0.07%
Aus  269 52.40% 1.90% 25.28% 13.75% TGTCACGCCCGGAATTTCTATCCAAAAATTCCAAAC: 4.83%; TGTCACGCCCG: 1.12%; TGTCAC: 0.74%
Indica I  595 76.50% 1.70% 9.41% 10.92% TGTCACGCCCG: 0.84%; TGTCACGCCCGGAATTTCTATCCAAAAATTCCAAAC: 0.67%
Indica II  465 62.80% 10.50% 10.54% 14.84% TGTCACGCCCG: 0.65%; TGTCAC: 0.43%; TGTCACGCCCGGAATTTCTATCCAAAAATTCCAAAC: 0.22%
Indica III  913 82.40% 6.00% 6.57% 3.50% TGTCACGCCCG: 0.77%; TGTCACGCCCGGAATTTCTATCCAAAAATTCCAAAC: 0.66%; TGTCAC: 0.11%
Indica Intermediate  786 80.90% 3.60% 8.14% 5.47% TGTCACGCCCGGAATTTCTATCCAAAAATTCCAAAC: 0.89%; TGTCACGCCCG: 0.64%; TGTCAC: 0.38%
Temperate Japonica  767 4.60% 95.40% 0.00% 0.00% NA
Tropical Japonica  504 60.90% 38.50% 0.20% 0.20% TGTCACGCCCG: 0.20%
Japonica Intermediate  241 20.30% 78.80% 0.41% 0.41% NA
VI/Aromatic  96 91.70% 3.10% 1.04% 4.17% NA
Intermediate  90 65.60% 24.40% 6.67% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216763017 T -> TGTCACGCCCGGAATTTCTATCCAAAAATT CCAAAC LOC_Os02g28350.1 downstream_gene_variant ; 2573.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> TGTCACGCCCGGAATTTCTATCCAAAAATT CCAAAC LOC_Os02g28360.1 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> TGTCACGCCCGGAATTTCTATCCAAAAATT CCAAAC LOC_Os02g28370.1 downstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> TGTCACGCCCGGAATTTCTATCCAAAAATT CCAAAC LOC_Os02g28360-LOC_Os02g28370 intergenic_region ; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> DEL N N silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> TGTCACGCCCG LOC_Os02g28350.1 downstream_gene_variant ; 2573.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> TGTCACGCCCG LOC_Os02g28360.1 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> TGTCACGCCCG LOC_Os02g28370.1 downstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> TGTCACGCCCG LOC_Os02g28360-LOC_Os02g28370 intergenic_region ; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> C LOC_Os02g28350.1 downstream_gene_variant ; 2572.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> C LOC_Os02g28360.1 downstream_gene_variant ; 340.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> C LOC_Os02g28370.1 downstream_gene_variant ; 2871.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> C LOC_Os02g28360-LOC_Os02g28370 intergenic_region ; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> TGTCAC LOC_Os02g28350.1 downstream_gene_variant ; 2573.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> TGTCAC LOC_Os02g28360.1 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> TGTCAC LOC_Os02g28370.1 downstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N
vg0216763017 T -> TGTCAC LOC_Os02g28360-LOC_Os02g28370 intergenic_region ; MODIFIER silent_mutation Average:79.774; most accessible tissue: Zhenshan97 young leaf, score: 92.168 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0216763017 T C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01
vg0216763017 T TGTCA* 0.04 0.01 0.0 0.16 0.15 0.16

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216763017 6.65E-10 3.90E-45 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.16E-07 3.42E-11 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.98E-11 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.81E-09 1.14E-46 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 3.64E-10 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.70E-06 6.59E-17 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 3.03E-06 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.41E-06 6.79E-16 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.56E-09 7.37E-43 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 5.77E-07 4.44E-16 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.84E-08 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.63E-11 1.35E-46 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.81E-07 8.02E-11 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 3.47E-07 6.33E-17 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.41E-12 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.40E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.65E-08 8.67E-37 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.39E-09 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.55E-11 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.13E-21 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 3.91E-08 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.26E-21 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 4.27E-09 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 8.55E-08 1.85E-34 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 8.30E-06 5.53E-11 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.64E-07 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 9.87E-16 4.24E-25 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 4.73E-18 1.24E-28 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 9.99E-16 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.32E-06 2.09E-10 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 7.08E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.55E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.80E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.02E-06 4.49E-31 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.71E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 8.84E-06 2.18E-13 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.26E-10 1.61E-46 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 8.13E-11 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 6.49E-14 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.62E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.68E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 8.00E-08 6.19E-12 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.21E-08 NA mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 3.17E-06 9.98E-12 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 9.69E-12 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 5.31E-10 5.10E-14 mr1603 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 9.47E-06 1.63E-06 mr1603 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.49E-06 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 4.11E-09 5.48E-14 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.16E-09 5.59E-12 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 7.79E-06 mr1632 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.21E-06 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 7.00E-09 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 8.54E-09 1.31E-12 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 3.60E-21 1.52E-21 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 4.69E-27 3.11E-55 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.42E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 5.33E-08 NA mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.05E-08 1.47E-09 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 3.76E-12 3.52E-22 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 4.93E-13 1.48E-17 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 7.24E-11 3.85E-19 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.39E-12 1.74E-16 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.06E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 8.88E-12 1.14E-57 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.17E-13 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 4.73E-07 6.96E-16 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 6.16E-11 1.51E-54 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.41E-11 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 8.34E-09 3.80E-19 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.41E-06 NA mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.21E-18 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.32E-12 2.13E-52 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.41E-07 7.68E-21 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 6.75E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 6.18E-09 NA mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.64E-09 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.34E-07 1.12E-15 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 5.29E-06 NA mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 6.58E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.37E-06 8.63E-12 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.40E-09 2.78E-27 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 3.63E-06 3.34E-11 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.89E-09 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 3.24E-06 1.06E-11 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 8.23E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 5.94E-11 1.28E-53 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 6.94E-15 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.23E-11 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 9.97E-08 3.57E-31 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 5.55E-06 1.89E-12 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 5.88E-10 6.36E-33 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 5.05E-07 8.71E-15 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 8.28E-13 1.54E-53 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 7.27E-07 2.38E-19 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 3.49E-11 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 4.37E-18 1.50E-26 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.44E-18 7.99E-38 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 7.20E-17 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 9.93E-06 8.31E-16 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.47E-07 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.89E-06 NA mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 6.83E-07 4.04E-33 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 3.35E-07 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 3.00E-06 3.93E-11 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 7.89E-11 1.95E-53 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.03E-14 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.47E-11 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 5.45E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.05E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 4.02E-07 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.67E-09 mr1585_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 7.76E-08 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 7.71E-11 7.75E-58 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.86E-15 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 9.87E-07 2.00E-13 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 7.35E-10 2.80E-13 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.67E-07 2.66E-07 mr1603_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 5.53E-08 4.57E-10 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.47E-06 1.72E-10 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 9.35E-14 2.81E-21 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.81E-12 8.71E-25 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.50E-09 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.89E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.50E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 2.54E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 6.54E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 6.79E-08 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 7.99E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 5.44E-08 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 7.49E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.70E-13 3.62E-12 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.30E-13 8.71E-24 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.16E-28 9.57E-24 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.56E-38 3.80E-67 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.46E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 1.10E-15 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.81E-16 1.18E-26 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 8.26E-21 4.93E-36 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 9.33E-22 9.82E-50 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.62E-18 8.14E-31 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 2.09E-17 1.52E-39 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216763017 NA 1.82E-08 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251