RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0216744755:

Variant ID: vg0216744755 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16744755
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, C: 0.04, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCTTCTGGGTCGGTGCTCCCATCGTATTTCTCTATTGCTCCAGGTCGGAATCTTTCAGGCCATCGGACATCTCGAAGTGAATGGCCGAAAGCTGTAAC[A/C]
CAGCGCTGGGGGCGGTGGGTTGTCGGCGATCGTACGTCCTTTGCGGATGTCTATCTGATGATGAGGATGAGGAAGATGACGATGATGACGATGGGTCGCT

Reverse complement sequence

AGCGACCCATCGTCATCATCGTCATCTTCCTCATCCTCATCATCAGATAGACATCCGCAAAGGACGTACGATCGCCGACAACCCACCGCCCCCAGCGCTG[T/G]
GTTACAGCTTTCGGCCATTCACTTCGAGATGTCCGATGGCCTGAAAGATTCCGACCTGGAGCAATAGAGAAATACGATGGGAGCACCGACCCAGAAGAAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.20%	26.60%	0.13%	0.00%	NA
All Indica	2759	95.60%	4.20%	0.22%	0.00%	NA
All Japonica	1512	26.20%	73.80%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.20%	0.50%	0.34%	0.00%	NA
Indica II	465	90.30%	9.50%	0.22%	0.00%	NA
Indica III	913	95.10%	4.90%	0.00%	0.00%	NA
Indica Intermediate	786	96.70%	2.90%	0.38%	0.00%	NA
Temperate Japonica	767	4.40%	95.60%	0.00%	0.00%	NA
Tropical Japonica	504	61.70%	38.30%	0.00%	0.00%	NA
Japonica Intermediate	241	21.20%	78.80%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216744755	A -> C	LOC_Os02g28334.1	downstream_gene_variant ; 2782.0bp to feature; MODIFIER	silent_mutation	Average:48.972; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg0216744755	A -> C	LOC_Os02g28330.1	intron_variant ; MODIFIER	silent_mutation	Average:48.972; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216744755	NA	2.94E-49	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216744755	NA	1.19E-40	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216744755	NA	3.27E-28	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216744755	NA	1.14E-41	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216744755	NA	1.24E-47	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216744755	2.22E-12	3.04E-56	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216744755	6.41E-06	2.17E-14	mr1089	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216744755	8.58E-17	8.26E-69	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216744755	6.03E-08	3.04E-19	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216744755	5.81E-08	7.71E-35	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 93 entries

Previous1 2 3 4 5…10Next

Search for Variation information by Variation ID:

Detailed information for vg0216744755:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact