| Variant ID: vg0216721532 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16721532 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 68. )
TTTTTTTTAGAGAAAAGGTCAGAGACTCGGCTTTTTACTGAAAGCCACATCGAAGTGTTCAGCTGGGGTTGCCAGCGACAAAGAGGAGTTCAAGAAAATA[C/T]
AGACCAGGAACAGCAACCAGACTGGCGAACAAGTAGCGAACGATCTAGATTCCAGCCGAAACTCTAAGCTGACAACGACATGAGCCAGGGAAACATCTAC
GTAGATGTTTCCCTGGCTCATGTCGTTGTCAGCTTAGAGTTTCGGCTGGAATCTAGATCGTTCGCTACTTGTTCGCCAGTCTGGTTGCTGTTCCTGGTCT[G/A]
TATTTTCTTGAACTCCTCTTTGTCGCTGGCAACCCCAGCTGAACACTTCGATGTGGCTTTCAGTAAAAAGCCGAGTCTCTGACCTTTTCTCTAAAAAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.40% | 29.50% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 91.30% | 8.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.80% | 5.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 4.40% | 95.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 61.30% | 38.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 20.70% | 79.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 27.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216721532 | C -> T | LOC_Os02g28270.1 | upstream_gene_variant ; 2449.0bp to feature; MODIFIER | silent_mutation | Average:47.3; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0216721532 | C -> T | LOC_Os02g28290.1 | upstream_gene_variant ; 2101.0bp to feature; MODIFIER | silent_mutation | Average:47.3; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0216721532 | C -> T | LOC_Os02g28300.1 | upstream_gene_variant ; 4843.0bp to feature; MODIFIER | silent_mutation | Average:47.3; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0216721532 | C -> T | LOC_Os02g28280.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.3; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216721532 | NA | 2.83E-10 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216721532 | NA | 1.28E-11 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216721532 | NA | 9.14E-07 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216721532 | 3.65E-06 | 4.58E-13 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216721532 | 1.02E-08 | 2.44E-12 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216721532 | 1.07E-11 | 1.42E-55 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216721532 | 8.12E-11 | 1.08E-14 | mr1089 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216721532 | NA | 5.83E-11 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216721532 | 5.15E-18 | 2.05E-69 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216721532 | 5.15E-13 | 1.77E-20 | mr1093 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/