Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216714952:

Variant ID: vg0216714952 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16714952
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.19, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCCTTTTATAGTTTGTCCGGAAATATTACCGAGTGTAGGGTAGTCATTAATGGTGCAGAACAATAGAACTCTTAGCTTGAAGTTCTCCTGACCATATG[T/C]
ATCCCAAGTTTCCACACCTTCTTTCCAAAGAATCTCCAGATCGTCGATAATAGGCTCCAGGAATACATCGATATCATTGCCGGGTTGCCTTGGACCTTGG

Reverse complement sequence

CCAAGGTCCAAGGCAACCCGGCAATGATATCGATGTATTCCTGGAGCCTATTATCGACGATCTGGAGATTCTTTGGAAAGAAGGTGTGGAAACTTGGGAT[A/G]
CATATGGTCAGGAGAACTTCAAGCTAAGAGTTCTATTGTTCTGCACCATTAATGACTACCCTACACTCGGTAATATTTCCGGACAAACTATAAAAGGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.40%	4.90%	27.36%	38.34%	NA
All Indica	2759	7.90%	6.20%	34.11%	51.79%	NA
All Japonica	1512	74.30%	1.90%	6.75%	17.00%	NA
Aus	269	4.80%	11.20%	73.98%	10.04%	NA
Indica I	595	8.40%	0.80%	40.34%	50.42%	NA
Indica II	465	13.30%	2.60%	27.53%	56.56%	NA
Indica III	913	6.10%	12.80%	33.30%	47.75%	NA
Indica Intermediate	786	6.50%	4.60%	34.22%	54.71%	NA
Temperate Japonica	767	95.70%	0.40%	0.91%	3.00%	NA
Tropical Japonica	504	39.70%	4.80%	15.87%	39.68%	NA
Japonica Intermediate	241	78.80%	0.80%	6.22%	14.11%	NA
VI/Aromatic	96	4.20%	3.10%	29.17%	63.54%	NA
Intermediate	90	32.20%	0.00%	25.56%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216714952	T -> DEL	LOC_Os02g28260.1	N	frameshift_variant	Average:27.589; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0216714952	T -> C	LOC_Os02g28260.1	missense_variant ; p.Thr138Ala; MODERATE	nonsynonymous_codon ; T138A	Average:27.589; most accessible tissue: Minghui63 flag leaf, score: 59.912	benign	-0.562	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216714952	NA	4.65E-06	mr1039	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	8.51E-06	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	4.18E-10	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	1.60E-13	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	3.27E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	2.69E-12	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	4.16E-09	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	5.21E-08	mr1257	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	1.59E-09	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	3.19E-11	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	1.32E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	4.17E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	1.78E-09	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	1.11E-06	1.11E-06	mr1866	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	1.65E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	9.36E-13	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	5.55E-06	2.93E-15	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	6.59E-11	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	1.02E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	3.45E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	5.60E-09	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	2.91E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	2.83E-08	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	5.77E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	8.19E-10	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	1.49E-08	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216714952	NA	9.70E-07	mr1807_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251