| Variant ID: vg0216673470 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16673470 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 86. )
CCAAGTCATGGCTAATCAGACTCAAACAGTGGAAGAGTTGTTACAACAGATACGACGTCGGTACGAGATATACCAGATGCAGCAGATGCAACGACAATGT[T/C]
AGGAGCCGCGGCAAGGCCACCAGCCACAAATGCAAGTCCAGGTGCTAGCCCAGAACCTGAATCAGAGTCAGAGTCAGGAGTTCCCAGTATCGGCACCGAA
TTCGGTGCCGATACTGGGAACTCCTGACTCTGACTCTGATTCAGGTTCTGGGCTAGCACCTGGACTTGCATTTGTGGCTGGTGGCCTTGCCGCGGCTCCT[A/G]
ACATTGTCGTTGCATCTGCTGCATCTGGTATATCTCGTACCGACGTCGTATCTGTTGTAACAACTCTTCCACTGTTTGAGTCTGATTAGCCATGACTTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.50% | 33.90% | 4.82% | 15.72% | NA |
| All Indica | 2759 | 67.20% | 15.70% | 6.02% | 11.09% | NA |
| All Japonica | 1512 | 2.20% | 73.90% | 1.46% | 22.49% | NA |
| Aus | 269 | 49.40% | 7.80% | 13.38% | 29.37% | NA |
| Indica I | 595 | 65.00% | 15.00% | 6.05% | 13.95% | NA |
| Indica II | 465 | 78.90% | 15.10% | 3.44% | 2.58% | NA |
| Indica III | 913 | 60.40% | 19.70% | 7.56% | 12.38% | NA |
| Indica Intermediate | 786 | 69.70% | 12.10% | 5.73% | 12.47% | NA |
| Temperate Japonica | 767 | 1.20% | 94.50% | 0.91% | 3.39% | NA |
| Tropical Japonica | 504 | 3.00% | 40.10% | 2.98% | 53.97% | NA |
| Japonica Intermediate | 241 | 3.70% | 78.80% | 0.00% | 17.43% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 31.10% | 4.44% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216673470 | T -> DEL | LOC_Os02g28160.1 | N | frameshift_variant | Average:49.992; most accessible tissue: Zhenshan97 young leaf, score: 79.225 | N | N | N | N |
| vg0216673470 | T -> C | LOC_Os02g28160.1 | missense_variant ; p.Leu2Ser; MODERATE | nonsynonymous_codon ; L2S | Average:49.992; most accessible tissue: Zhenshan97 young leaf, score: 79.225 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216673470 | NA | 6.60E-11 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216673470 | NA | 1.54E-13 | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216673470 | NA | 9.77E-10 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216673470 | NA | 6.68E-12 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216673470 | NA | 6.88E-10 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216673470 | 7.13E-06 | 2.52E-09 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216673470 | NA | 3.22E-49 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216673470 | NA | 8.98E-08 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216673470 | NA | 1.36E-09 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216673470 | 2.81E-09 | 7.53E-61 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/