| Variant ID: vg0216662827 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16662827 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 85. )
AGCACTGGAAATTTCATTAACCATAGTCTAGATCAGAAGATCTGCACGTTCTTTTTCATCCGATTCTTCAATTTCTTCAGTACTAAGCATAAACCCATAG[C/T]
ACCTTAAATCTCATAAATCCTTGCCTAACATCACGAGAGAGCAAGAGAAAAATACAACAACAACTGAATCTAGGTAGCCTAACATTACGAGACAGCAGGA
TCCTGCTGTCTCGTAATGTTAGGCTACCTAGATTCAGTTGTTGTTGTATTTTTCTCTTGCTCTCTCGTGATGTTAGGCAAGGATTTATGAGATTTAAGGT[G/A]
CTATGGGTTTATGCTTAGTACTGAAGAAATTGAAGAATCGGATGAAAAAGAACGTGCAGATCTTCTGATCTAGACTATGGTTAATGAAATTTCCAGTGCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.40% | 27.10% | 4.21% | 38.30% | NA |
| All Indica | 2759 | 43.70% | 4.60% | 6.31% | 45.38% | NA |
| All Japonica | 1512 | 1.10% | 74.10% | 0.13% | 24.60% | NA |
| Aus | 269 | 36.10% | 0.70% | 6.32% | 56.88% | NA |
| Indica I | 595 | 26.40% | 1.20% | 5.04% | 67.39% | NA |
| Indica II | 465 | 38.70% | 9.50% | 12.04% | 39.78% | NA |
| Indica III | 913 | 60.80% | 5.30% | 3.94% | 30.01% | NA |
| Indica Intermediate | 786 | 39.90% | 3.60% | 6.62% | 49.87% | NA |
| Temperate Japonica | 767 | 0.10% | 95.80% | 0.00% | 4.04% | NA |
| Tropical Japonica | 504 | 1.80% | 38.90% | 0.20% | 59.13% | NA |
| Japonica Intermediate | 241 | 2.90% | 78.80% | 0.41% | 17.84% | NA |
| VI/Aromatic | 96 | 94.80% | 3.10% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 30.00% | 28.90% | 5.56% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216662827 | C -> T | LOC_Os02g28140.1 | upstream_gene_variant ; 1280.0bp to feature; MODIFIER | silent_mutation | Average:46.616; most accessible tissue: Minghui63 flower, score: 80.968 | N | N | N | N |
| vg0216662827 | C -> T | LOC_Os02g28130.1 | downstream_gene_variant ; 1332.0bp to feature; MODIFIER | silent_mutation | Average:46.616; most accessible tissue: Minghui63 flower, score: 80.968 | N | N | N | N |
| vg0216662827 | C -> T | LOC_Os02g28130-LOC_Os02g28140 | intergenic_region ; MODIFIER | silent_mutation | Average:46.616; most accessible tissue: Minghui63 flower, score: 80.968 | N | N | N | N |
| vg0216662827 | C -> DEL | N | N | silent_mutation | Average:46.616; most accessible tissue: Minghui63 flower, score: 80.968 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216662827 | 1.06E-07 | 3.53E-42 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662827 | 5.92E-07 | 1.08E-09 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662827 | 3.80E-11 | 8.95E-51 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662827 | 1.14E-09 | 5.07E-15 | mr1093 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662827 | 6.62E-09 | NA | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662827 | 8.82E-08 | 2.14E-10 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662827 | 2.18E-07 | 1.83E-36 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662827 | 3.43E-07 | 1.40E-10 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662827 | 2.08E-08 | 3.09E-43 | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662827 | 7.38E-08 | 5.87E-11 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/