\
| Variant ID: vg0216662170 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16662170 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 84. )
TTGACTAGGTCTCCATCCCACGTGGCAATGACGTGGCGCTTACGTGGCAATTATATCTCAGAAAAATAATAAATAACCATGGGTCCACGTGTCAGCTACA[C/T]
ACAAAAAATAATTTAAAAATGGTGGGACCCACGTGGGCCCACATGTCAATGACAAAAAAAAAAATATGGTGGGGCCCACGTGGGCCCCACATGTCATTCC
GGAATGACATGTGGGGCCCACGTGGGCCCCACCATATTTTTTTTTTTGTCATTGACATGTGGGCCCACGTGGGTCCCACCATTTTTAAATTATTTTTTGT[G/A]
TGTAGCTGACACGTGGACCCATGGTTATTTATTATTTTTCTGAGATATAATTGCCACGTAAGCGCCACGTCATTGCCACGTGGGATGGAGACCTAGTCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.50% | 28.00% | 0.53% | 25.05% | NA |
| All Indica | 2759 | 28.50% | 46.80% | 0.65% | 24.14% | NA |
| All Japonica | 1512 | 75.20% | 0.70% | 0.33% | 23.74% | NA |
| Aus | 269 | 49.80% | 0.00% | 0.00% | 50.19% | NA |
| Indica I | 595 | 24.70% | 41.70% | 0.67% | 32.94% | NA |
| Indica II | 465 | 40.20% | 49.50% | 0.65% | 9.68% | NA |
| Indica III | 913 | 28.70% | 44.80% | 0.44% | 26.07% | NA |
| Indica Intermediate | 786 | 24.00% | 51.30% | 0.89% | 23.79% | NA |
| Temperate Japonica | 767 | 96.00% | 0.80% | 0.00% | 3.26% | NA |
| Tropical Japonica | 504 | 40.50% | 0.60% | 0.99% | 57.94% | NA |
| Japonica Intermediate | 241 | 81.70% | 0.80% | 0.00% | 17.43% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 22.20% | 2.22% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216662170 | C -> T | LOC_Os02g28140.1 | upstream_gene_variant ; 1937.0bp to feature; MODIFIER | silent_mutation | Average:49.312; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg0216662170 | C -> T | LOC_Os02g28130.1 | downstream_gene_variant ; 675.0bp to feature; MODIFIER | silent_mutation | Average:49.312; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg0216662170 | C -> T | LOC_Os02g28130-LOC_Os02g28140 | intergenic_region ; MODIFIER | silent_mutation | Average:49.312; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg0216662170 | C -> DEL | N | N | silent_mutation | Average:49.312; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216662170 | 1.91E-13 | NA | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.03E-15 | 1.31E-20 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 3.69E-11 | NA | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 3.00E-12 | 4.19E-18 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 3.84E-19 | 3.78E-63 | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.27E-19 | 7.01E-33 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 6.51E-18 | 1.82E-54 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 5.72E-18 | 4.20E-33 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.35E-12 | NA | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.12E-14 | 7.39E-20 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 1.41E-08 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 2.79E-10 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.28E-07 | NA | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 8.81E-08 | 7.77E-10 | mr1243 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.06E-12 | 6.53E-42 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 6.02E-11 | 5.96E-24 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 8.27E-09 | 4.66E-22 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.35E-13 | 7.98E-19 | mr1253 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 5.49E-14 | 8.62E-40 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 4.33E-15 | 6.90E-26 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.60E-18 | 4.12E-53 | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.53E-19 | 1.27E-32 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 8.48E-12 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 4.07E-08 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 3.21E-08 | mr1350 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 1.27E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 6.79E-14 | 7.64E-33 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.46E-13 | 1.48E-21 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.56E-18 | 6.36E-51 | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.30E-16 | 8.93E-30 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 8.89E-07 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 4.19E-07 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.43E-12 | NA | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.78E-16 | 3.64E-26 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 2.89E-09 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 3.35E-18 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 8.30E-14 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 1.65E-06 | mr1914 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.10E-15 | NA | mr1089_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 7.55E-16 | 1.26E-27 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.94E-12 | NA | mr1093_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.49E-11 | 1.47E-21 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 5.97E-18 | 1.98E-73 | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.68E-15 | 4.30E-38 | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.55E-21 | 1.22E-66 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.48E-20 | 3.73E-47 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 9.72E-06 | mr1229_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.22E-10 | NA | mr1235_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 4.26E-10 | 4.71E-20 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 8.57E-09 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 9.35E-08 | 1.68E-13 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 8.11E-10 | NA | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.04E-08 | 1.03E-13 | mr1243_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.87E-09 | 5.26E-21 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.15E-09 | 4.04E-16 | mr1248_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.03E-16 | 1.45E-54 | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.32E-17 | 6.54E-35 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.27E-12 | 1.13E-32 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 3.20E-12 | 1.35E-20 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 4.19E-16 | 8.60E-50 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 8.86E-14 | 3.83E-33 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.92E-17 | 1.06E-65 | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.94E-16 | 3.13E-43 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 1.11E-15 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 1.08E-12 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.46E-08 | 4.64E-22 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.78E-07 | 6.81E-15 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 3.38E-12 | 2.18E-30 | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 4.92E-11 | 1.87E-19 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.09E-16 | 1.48E-54 | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.49E-17 | 8.55E-35 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 8.76E-06 | mr1577_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 5.72E-16 | NA | mr1599_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 3.26E-15 | 9.63E-32 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 4.71E-06 | 8.73E-15 | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 2.71E-06 | 5.76E-12 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 1.92E-09 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 1.26E-09 | NA | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 4.21E-09 | 1.62E-24 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 3.31E-06 | mr1880_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 9.20E-10 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 6.69E-06 | 2.34E-22 | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 2.11E-15 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | 8.13E-06 | 2.38E-18 | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216662170 | NA | 1.22E-12 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |