\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216646059:

Variant ID: vg0216646059 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16646059
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATACCCTACTCCTGTGCTTGGTTGATTGAGTGTAGAACACCAGTGCTTGAGGTTGCGAGACCCAAGCGCGAGTTTGCTCGGAAGTTCCCCCCTCGACC[A/G]
CTAGGCCTGGACCTCCTTTTATACCTCAAGGGGTTACCACATGGGCCCAACAACCTAACCTAGCTCCGGTGGAGAAGTATTATAATCTTCGCATTAAATG

Reverse complement sequence

CATTTAATGCGAAGATTATAATACTTCTCCACCGGAGCTAGGTTAGGTTGTTGGGCCCATGTGGTAACCCCTTGAGGTATAAAAGGAGGTCCAGGCCTAG[T/C]
GGTCGAGGGGGGAACTTCCGAGCAAACTCGCGCTTGGGTCTCGCAACCTCAAGCACTGGTGTTCTACACTCAATCAACCAAGCACAGGAGTAGGGTATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 3.80% 7.09% 6.45% NA
All Indica  2759 88.10% 2.80% 8.37% 0.76% NA
All Japonica  1512 75.90% 4.90% 2.12% 17.13% NA
Aus  269 62.10% 8.60% 22.30% 7.06% NA
Indica I  595 80.50% 2.90% 15.80% 0.84% NA
Indica II  465 92.70% 1.70% 5.59% 0.00% NA
Indica III  913 89.70% 3.10% 6.13% 1.10% NA
Indica Intermediate  786 89.30% 2.90% 7.00% 0.76% NA
Temperate Japonica  767 96.60% 0.30% 0.39% 2.74% NA
Tropical Japonica  504 41.30% 13.30% 4.56% 40.87% NA
Japonica Intermediate  241 82.20% 2.10% 2.49% 13.28% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 74.40% 7.80% 12.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216646059 A -> G LOC_Os02g28110.1 upstream_gene_variant ; 4779.0bp to feature; MODIFIER silent_mutation Average:43.654; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg0216646059 A -> G LOC_Os02g28110-LOC_Os02g28120 intergenic_region ; MODIFIER silent_mutation Average:43.654; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg0216646059 A -> DEL N N silent_mutation Average:43.654; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216646059 NA 8.98E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 3.22E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 8.47E-06 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 2.28E-11 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 2.04E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 7.93E-09 8.38E-17 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 5.57E-06 5.57E-06 mr1248 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 5.55E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 7.83E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 9.19E-09 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 5.30E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 2.41E-12 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 7.96E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 6.35E-07 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 7.53E-06 mr1632 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 6.47E-07 6.47E-07 mr1905 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 2.10E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 5.41E-11 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 1.57E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 5.78E-09 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 5.03E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 2.83E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 2.36E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 9.72E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 1.54E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 6.42E-06 1.01E-10 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 4.04E-06 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 1.61E-08 1.35E-10 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 7.24E-08 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 5.15E-07 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216646059 NA 9.17E-09 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251