\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216629891:

Variant ID: vg0216629891 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 16629891
Reference Allele: GAAAlternative Allele: G,TAA,GA,AAA
Primary Allele: GAASecondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGGAACTAATCACATAGTAAATTAAAGTTTTACAGACTATTTAAACAGCCGCACAACAATTTTAAGCATTAATAAAATATTGTCCATTTCTAAAAAAT[GAA/G,TAA,GA,AAA]
AAAAAAATCGTCCTTTCATCCGAATGAAAATAAATTTAATAGAAGCAAACCCAACTTTTCAATTTAGGTACTAAATACTTTTATAAACATCTAACGGAAT

Reverse complement sequence

ATTCCGTTAGATGTTTATAAAAGTATTTAGTACCTAAATTGAAAAGTTGGGTTTGCTTCTATTAAATTTATTTTCATTCGGATGAAAGGACGATTTTTTT[TTC/C,TTA,TC,TTT]
ATTTTTTAGAAATGGACAATATTTTATTAATGCTTAAAATTGTTGTGCGGCTGTTTAAATAGTCTGTAAAACTTTAATTTACTATGTGATTAGTTCCCTC

Allele Frequencies:

Populations Population SizeFrequency of GAA(primary allele) Frequency of GA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 25.30% 2.20% 2.92% TAA: 16.50%; G: 0.15%; AAA: 0.02%
All Indica  2759 50.30% 25.50% 1.23% 2.68% TAA: 20.26%; AAA: 0.04%
All Japonica  1512 70.60% 21.20% 3.57% 3.37% TAA: 0.93%; G: 0.40%
Aus  269 0.40% 53.90% 4.83% 3.35% TAA: 37.55%
Indica I  595 41.30% 33.40% 2.18% 0.34% TAA: 22.69%
Indica II  465 58.50% 10.50% 0.43% 1.51% TAA: 29.03%
Indica III  913 48.50% 28.50% 1.31% 5.26% TAA: 16.43%
Indica Intermediate  786 54.20% 24.90% 0.89% 2.16% TAA: 17.68%; AAA: 0.13%
Temperate Japonica  767 95.80% 4.00% 0.13% 0.00% NA
Tropical Japonica  504 28.60% 50.20% 9.33% 9.52% TAA: 1.39%; G: 0.99%
Japonica Intermediate  241 78.00% 14.90% 2.49% 1.24% TAA: 2.90%; G: 0.41%
VI/Aromatic  96 3.10% 3.10% 0.00% 0.00% TAA: 93.75%
Intermediate  90 46.70% 26.70% 3.33% 4.44% TAA: 17.78%; G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216629891 GAA -> DEL N N silent_mutation Average:27.471; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0216629891 GAA -> TAA LOC_Os02g28074.1 intron_variant ; MODIFIER silent_mutation Average:27.471; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0216629891 GAA -> TAA LOC_Os02g28074.2 intron_variant ; MODIFIER silent_mutation Average:27.471; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0216629891 GAA -> AAA LOC_Os02g28074.1 intron_variant ; MODIFIER silent_mutation Average:27.471; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0216629891 GAA -> AAA LOC_Os02g28074.2 intron_variant ; MODIFIER silent_mutation Average:27.471; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0216629891 GAA -> G LOC_Os02g28074.1 intron_variant ; MODIFIER silent_mutation Average:27.471; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0216629891 GAA -> G LOC_Os02g28074.2 intron_variant ; MODIFIER silent_mutation Average:27.471; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0216629891 GAA -> GA LOC_Os02g28074.1 intron_variant ; MODIFIER silent_mutation Average:27.471; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0216629891 GAA -> GA LOC_Os02g28074.2 intron_variant ; MODIFIER silent_mutation Average:27.471; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216629891 NA 6.53E-10 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 5.80E-10 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 7.64E-07 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 6.01E-07 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 3.61E-08 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 3.04E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 3.28E-13 1.16E-18 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 3.93E-16 5.74E-33 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 3.63E-06 2.46E-08 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 1.27E-06 NA mr1409 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 6.85E-08 mr1409 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 3.27E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 9.90E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 4.29E-14 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 6.88E-10 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 3.69E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 4.95E-06 NA mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 2.11E-08 5.42E-10 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 5.68E-07 NA mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 1.44E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 3.95E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 1.33E-10 8.20E-17 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 1.05E-22 5.53E-62 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 2.45E-24 6.40E-66 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 1.57E-07 1.46E-10 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 1.19E-07 NA mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 1.80E-08 1.46E-13 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 7.22E-07 NA mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 8.77E-09 4.31E-13 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 1.05E-11 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 6.29E-07 1.46E-14 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 1.02E-06 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 1.44E-08 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 2.10E-06 3.59E-10 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 8.44E-07 1.28E-11 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 2.01E-12 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 2.34E-15 2.40E-26 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 1.91E-17 7.79E-42 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 1.73E-06 8.48E-11 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 2.61E-06 mr1409_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 1.17E-08 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 6.76E-08 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 1.12E-11 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 4.50E-08 mr1585_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 6.00E-08 3.61E-16 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 4.91E-10 5.14E-17 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 7.56E-08 1.49E-13 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 4.33E-10 3.32E-20 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 5.09E-06 NA mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 NA 2.16E-07 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 3.93E-12 2.79E-23 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 1.09E-13 6.02E-27 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 9.98E-33 4.25E-74 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 3.42E-36 1.66E-81 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 1.23E-15 2.95E-27 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 1.35E-16 5.22E-33 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 3.93E-18 5.13E-37 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 2.53E-19 1.45E-46 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 9.31E-16 2.20E-29 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216629891 3.22E-14 4.21E-37 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251