\
| Variant ID: vg0216627913 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16627913 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 200. )
TCCCATTTGGCAGCTCTTTTGGGTGAAGCAAATGCCTTATGTCCAAATTGACGAGGTCAGTCCGGGACTTCAACCCATCTTTCGTCTTACTCGGGATGTC[C/T]
AGTAAAGTGCCAATGGTGCTATCAAACACATTCTTCTCAAGATGCATTACGTCGATGGCATGACGAACCTCCAGGTCTTTCCAGTAATCCAGATACCTGA
TCAGGTATCTGGATTACTGGAAAGACCTGGAGGTTCGTCATGCCATCGACGTAATGCATCTTGAGAAGAATGTGTTTGATAGCACCATTGGCACTTTACT[G/A]
GACATCCCGAGTAAGACGAAAGATGGGTTGAAGTCCCGGACTGACCTCGTCAATTTGGACATAAGGCATTTGCTTCACCCAAAAGAGCTGCCAAATGGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.70% | 27.10% | 1.42% | 0.78% | NA |
| All Indica | 2759 | 55.40% | 40.90% | 2.39% | 1.27% | NA |
| All Japonica | 1512 | 98.90% | 1.00% | 0.00% | 0.07% | NA |
| Aus | 269 | 57.60% | 42.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 38.70% | 59.00% | 2.35% | 0.00% | NA |
| Indica II | 465 | 29.90% | 58.10% | 5.38% | 6.67% | NA |
| Indica III | 913 | 86.20% | 13.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 47.50% | 48.90% | 3.18% | 0.51% | NA |
| Temperate Japonica | 767 | 99.20% | 0.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 22.20% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216627913 | C -> T | LOC_Os02g28074.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.626; most accessible tissue: Minghui63 flag leaf, score: 56.489 | N | N | N | N |
| vg0216627913 | C -> T | LOC_Os02g28074.2 | intron_variant ; MODIFIER | silent_mutation | Average:43.626; most accessible tissue: Minghui63 flag leaf, score: 56.489 | N | N | N | N |
| vg0216627913 | C -> DEL | N | N | silent_mutation | Average:43.626; most accessible tissue: Minghui63 flag leaf, score: 56.489 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216627913 | NA | 2.44E-07 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 5.53E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 4.59E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 9.85E-06 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 3.79E-06 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 6.28E-08 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 1.31E-08 | NA | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 2.67E-09 | 1.16E-11 | mr1317 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 5.57E-06 | 3.54E-14 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 2.08E-06 | 2.08E-06 | mr1379 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 2.06E-06 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 5.10E-07 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 2.26E-06 | 1.06E-15 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 7.47E-07 | mr1559 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 5.27E-06 | 3.53E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 2.75E-12 | 2.34E-20 | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 7.33E-13 | 4.49E-12 | mr1855 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 5.63E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 2.35E-07 | NA | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 1.16E-07 | 1.65E-09 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 3.53E-08 | 6.69E-19 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 2.99E-06 | 8.91E-09 | mr1379_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 1.89E-06 | mr1409_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 7.63E-07 | 8.53E-16 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 2.09E-08 | mr1559_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | NA | 3.51E-09 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 6.71E-07 | 5.86E-10 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 4.84E-07 | 3.38E-08 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 2.73E-13 | NA | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 4.70E-12 | 2.63E-10 | mr1855_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 4.11E-08 | 5.80E-13 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 3.51E-08 | 6.94E-09 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 3.06E-09 | NA | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 1.52E-09 | 2.20E-08 | mr1914_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 9.83E-09 | NA | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216627913 | 5.58E-08 | 6.44E-08 | mr1927_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |