\
| Variant ID: vg0216623044 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16623044 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.03, others allele: 0.00, population size: 86. )
TCATACATAAATGCTTCGACTCTGCATCTTATGGTACAAACTTAATTGCTGCAGGTACTACCCATTCTATGTTGCTCCTTTCGTATCTGACCTCAAAAGT[A/C]
ATTGTCGGTTCGAGATATCTTTCACCGTAGACAAACCACTGCGACCATTTGATCAGCTCATGGCAGTTTTACCACTACGAAGGCATGCACTTTCACCATT
AATGGTGAAAGTGCATGCCTTCGTAGTGGTAAAACTGCCATGAGCTGATCAAATGGTCGCAGTGGTTTGTCTACGGTGAAAGATATCTCGAACCGACAAT[T/G]
ACTTTTGAGGTCAGATACGAAAGGAGCAACATAGAATGGGTAGTACCTGCAGCAATTAAGTTTGTACCATAAGATGCAGAGTCGAAGCATTTATGTATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.60% | 26.40% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 96.00% | 4.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 26.40% | 73.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 4.70% | 95.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 61.90% | 38.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 21.20% | 78.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216623044 | A -> C | LOC_Os02g28074.1 | missense_variant ; p.Asn472His; MODERATE | nonsynonymous_codon | Average:70.146; most accessible tissue: Zhenshan97 panicle, score: 81.752 | benign |
-1.202 |
TOLERATED | 0.11 |
| vg0216623044 | A -> C | LOC_Os02g28074.2 | missense_variant ; p.Asn406His; MODERATE | nonsynonymous_codon | Average:70.146; most accessible tissue: Zhenshan97 panicle, score: 81.752 | benign |
-1.273 |
TOLERATED | 0.11 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216623044 | NA | 9.56E-49 | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.31E-40 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 4.99E-72 | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 8.13E-28 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.39E-60 | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.58E-40 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.34E-47 | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 1.06E-12 | 4.51E-57 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.30E-12 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 6.22E-20 | 1.65E-71 | mr1093 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 3.13E-07 | 2.68E-18 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 9.13E-08 | 1.13E-34 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.12E-08 | mr1129 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 4.99E-72 | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 5.46E-65 | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 7.81E-60 | mr1178 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 5.71E-15 | 3.69E-60 | mr1235 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 2.42E-06 | 8.04E-16 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 5.16E-53 | mr1241 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 5.18E-09 | 2.47E-41 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 9.57E-12 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.03E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.55E-28 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.37E-10 | mr1251 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 4.09E-17 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 7.32E-08 | 1.73E-31 | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 3.06E-08 | mr1257 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.64E-85 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 3.40E-14 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 7.59E-57 | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.51E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 2.16E-13 | 3.89E-43 | mr1423 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 5.68E-06 | 6.81E-14 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 2.91E-09 | 2.68E-46 | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 3.47E-14 | mr1435 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.49E-11 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.50E-55 | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.38E-64 | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 8.26E-13 | 2.79E-63 | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 3.31E-11 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 3.99E-06 | NA | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.06E-06 | mr1603 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 8.02E-21 | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.43E-08 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 4.92E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 4.21E-33 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.53E-33 | mr1780 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.42E-08 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.04E-25 | mr1805 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.31E-12 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.31E-23 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.06E-07 | mr1862 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 7.04E-39 | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.61E-07 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.55E-53 | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 2.95E-14 | 3.46E-73 | mr1089_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 3.34E-07 | 3.07E-16 | mr1089_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 4.41E-19 | 1.22E-84 | mr1093_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 2.00E-09 | 5.03E-20 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 6.84E-06 | 9.87E-38 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 4.53E-07 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 4.25E-82 | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.44E-79 | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 3.19E-14 | 1.49E-80 | mr1235_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 6.24E-06 | 5.21E-14 | mr1235_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 3.85E-10 | 8.75E-57 | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.33E-10 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.38E-18 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.10E-08 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.53E-07 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 7.08E-09 | 4.99E-51 | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.27E-11 | mr1251_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 8.54E-21 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 6.23E-09 | 2.61E-44 | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 3.51E-06 | 8.74E-12 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.53E-63 | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 1.30E-09 | 5.34E-43 | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 3.03E-06 | 3.11E-11 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 1.16E-08 | 9.91E-51 | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.51E-11 | mr1435_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.83E-65 | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 7.22E-12 | 1.52E-78 | mr1599_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 5.14E-06 | 1.30E-12 | mr1599_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 6.18E-08 | NA | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | 2.55E-07 | 2.54E-07 | mr1603_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.31E-09 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 8.59E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 6.64E-07 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.05E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 2.09E-33 | mr1780_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.60E-08 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.98E-41 | mr1805_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 1.91E-07 | mr1807_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 3.68E-39 | mr1862_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216623044 | NA | 4.16E-07 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |