\
| Variant ID: vg0216616335 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16616335 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )
GCCAAAGAGTAAAAGATGGTTGCATGATATTGGAGAAGAGAGTTTCTAGTTTCTTTGCAATGAAAGGGTAGAACTTAAGAAGAAGATTAGAAGTTTAATG[C/T]
TCTCTCTTCTTTGCACTATGGGGTTTTTGTTGTCTTAAGTACTATTTTGGCTAATTTCTGTCATTGTCTAAGTGTCTATTTGTAGTCACTCAAATTTGTG
CACAAATTTGAGTGACTACAAATAGACACTTAGACAATGACAGAAATTAGCCAAAATAGTACTTAAGACAACAAAAACCCCATAGTGCAAAGAAGAGAGA[G/A]
CATTAAACTTCTAATCTTCTTCTTAAGTTCTACCCTTTCATTGCAAAGAAACTAGAAACTCTCTTCTCCAATATCATGCAACCATCTTTTACTCTTTGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.80% | 12.10% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 79.30% | 20.60% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 92.70% | 7.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 56.80% | 42.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216616335 | C -> T | LOC_Os02g28040.1 | upstream_gene_variant ; 4097.0bp to feature; MODIFIER | silent_mutation | Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0216616335 | C -> T | LOC_Os02g28074.1 | upstream_gene_variant ; 1076.0bp to feature; MODIFIER | silent_mutation | Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0216616335 | C -> T | LOC_Os02g28074.2 | upstream_gene_variant ; 1043.0bp to feature; MODIFIER | silent_mutation | Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0216616335 | C -> T | LOC_Os02g28074.3 | upstream_gene_variant ; 1076.0bp to feature; MODIFIER | silent_mutation | Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0216616335 | C -> T | LOC_Os02g28050.1 | downstream_gene_variant ; 30.0bp to feature; MODIFIER | silent_mutation | Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0216616335 | C -> T | LOC_Os02g28050-LOC_Os02g28074 | intergenic_region ; MODIFIER | silent_mutation | Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216616335 | 5.19E-07 | NA | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 6.14E-06 | NA | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 3.74E-08 | NA | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 1.66E-07 | 7.68E-07 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 8.36E-06 | NA | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | NA | 7.26E-06 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 1.76E-06 | NA | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | NA | 1.50E-06 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 2.91E-06 | NA | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | NA | 8.50E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 1.33E-06 | NA | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 1.13E-06 | 6.29E-07 | mr1423 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 1.35E-06 | NA | mr1435 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 5.54E-06 | 1.04E-06 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 2.10E-06 | NA | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 2.64E-06 | 3.49E-07 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 4.66E-06 | NA | mr1089_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 5.83E-06 | NA | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 7.60E-07 | NA | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 7.99E-07 | 1.14E-06 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 5.26E-06 | NA | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 7.63E-07 | 5.15E-07 | mr1251_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 8.36E-07 | NA | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 2.79E-06 | 4.46E-06 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 7.83E-07 | NA | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 4.13E-06 | 1.69E-06 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 4.70E-06 | NA | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 6.27E-06 | NA | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616335 | 9.35E-07 | 5.30E-07 | mr1435_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |