\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216616335:

Variant ID: vg0216616335 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16616335
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAAAGAGTAAAAGATGGTTGCATGATATTGGAGAAGAGAGTTTCTAGTTTCTTTGCAATGAAAGGGTAGAACTTAAGAAGAAGATTAGAAGTTTAATG[C/T]
TCTCTCTTCTTTGCACTATGGGGTTTTTGTTGTCTTAAGTACTATTTTGGCTAATTTCTGTCATTGTCTAAGTGTCTATTTGTAGTCACTCAAATTTGTG

Reverse complement sequence

CACAAATTTGAGTGACTACAAATAGACACTTAGACAATGACAGAAATTAGCCAAAATAGTACTTAAGACAACAAAAACCCCATAGTGCAAAGAAGAGAGA[G/A]
CATTAAACTTCTAATCTTCTTCTTAAGTTCTACCCTTTCATTGCAAAGAAACTAGAAACTCTCTTCTCCAATATCATGCAACCATCTTTTACTCTTTGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 12.10% 0.08% 0.00% NA
All Indica  2759 79.30% 20.60% 0.14% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 92.70% 7.10% 0.22% 0.00% NA
Indica III  913 56.80% 42.90% 0.22% 0.00% NA
Indica Intermediate  786 83.30% 16.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216616335 C -> T LOC_Os02g28040.1 upstream_gene_variant ; 4097.0bp to feature; MODIFIER silent_mutation Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg0216616335 C -> T LOC_Os02g28074.1 upstream_gene_variant ; 1076.0bp to feature; MODIFIER silent_mutation Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg0216616335 C -> T LOC_Os02g28074.2 upstream_gene_variant ; 1043.0bp to feature; MODIFIER silent_mutation Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg0216616335 C -> T LOC_Os02g28074.3 upstream_gene_variant ; 1076.0bp to feature; MODIFIER silent_mutation Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg0216616335 C -> T LOC_Os02g28050.1 downstream_gene_variant ; 30.0bp to feature; MODIFIER silent_mutation Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg0216616335 C -> T LOC_Os02g28050-LOC_Os02g28074 intergenic_region ; MODIFIER silent_mutation Average:55.968; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216616335 5.19E-07 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 6.14E-06 NA mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 3.74E-08 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 1.66E-07 7.68E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 8.36E-06 NA mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 NA 7.26E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 1.76E-06 NA mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 NA 1.50E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 2.91E-06 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 NA 8.50E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 1.33E-06 NA mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 1.13E-06 6.29E-07 mr1423 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 1.35E-06 NA mr1435 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 5.54E-06 1.04E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 2.10E-06 NA mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 2.64E-06 3.49E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 4.66E-06 NA mr1089_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 5.83E-06 NA mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 7.60E-07 NA mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 7.99E-07 1.14E-06 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 5.26E-06 NA mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 7.63E-07 5.15E-07 mr1251_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 8.36E-07 NA mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 2.79E-06 4.46E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 7.83E-07 NA mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 4.13E-06 1.69E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 4.70E-06 NA mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 6.27E-06 NA mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616335 9.35E-07 5.30E-07 mr1435_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251