\
| Variant ID: vg0216616004 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16616004 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )
GTTAAATGCTATTTTTGTGATTCTAATGAATCAATACAACATCTTTTCTTTGATTGTCCTCTTGCACGATTTATGTGGAATGTTGTCTTCATTTCTTTTG[G/A]
AATTCATCCGCCTAGGAATGTTGCTAGCTTATTAGGTAATTGGCTAAGGGGGGTTCAACCTAAACTAAAAACTCAAGTCTTTGGAGGGGTCGCAGCGTTG
CAACGCTGCGACCCCTCCAAAGACTTGAGTTTTTAGTTTAGGTTGAACCCCCCTTAGCCAATTACCTAATAAGCTAGCAACATTCCTAGGCGGATGAATT[C/T]
CAAAAGAAATGAAGACAACATTCCACATAAATCGTGCAAGAGGACAATCAAAGAAAAGATGTTGTATTGATTCATTAGAATCACAAAAATAGCATTTAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.40% | 14.30% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 75.80% | 23.80% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 99.40% | 0.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.90% | 36.60% | 0.50% | 0.00% | NA |
| Indica II | 465 | 59.60% | 39.60% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 67.70% | 31.80% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216616004 | G -> A | LOC_Os02g28040.1 | upstream_gene_variant ; 3766.0bp to feature; MODIFIER | silent_mutation | Average:46.27; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0216616004 | G -> A | LOC_Os02g28074.1 | upstream_gene_variant ; 1407.0bp to feature; MODIFIER | silent_mutation | Average:46.27; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0216616004 | G -> A | LOC_Os02g28074.2 | upstream_gene_variant ; 1374.0bp to feature; MODIFIER | silent_mutation | Average:46.27; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0216616004 | G -> A | LOC_Os02g28074.3 | upstream_gene_variant ; 1407.0bp to feature; MODIFIER | silent_mutation | Average:46.27; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0216616004 | G -> A | LOC_Os02g28050.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.27; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216616004 | NA | 1.56E-06 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | 2.46E-07 | NA | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | 1.67E-06 | 1.01E-12 | mr1109 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | 8.86E-07 | NA | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 8.14E-11 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 3.51E-06 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 9.04E-07 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 2.85E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 1.00E-07 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | 5.45E-06 | NA | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 1.44E-07 | mr1253 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | 3.66E-10 | 2.52E-24 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | 1.60E-07 | 4.40E-13 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | 2.59E-08 | NA | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | 6.07E-07 | 9.26E-12 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 5.32E-07 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | 6.49E-06 | NA | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 2.69E-09 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | 6.10E-07 | NA | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | 1.59E-06 | 1.11E-08 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 1.42E-10 | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 9.36E-11 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 2.12E-09 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 4.28E-09 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 1.78E-07 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 1.35E-11 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216616004 | NA | 1.07E-06 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |