\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216616004:

Variant ID: vg0216616004 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16616004
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAAATGCTATTTTTGTGATTCTAATGAATCAATACAACATCTTTTCTTTGATTGTCCTCTTGCACGATTTATGTGGAATGTTGTCTTCATTTCTTTTG[G/A]
AATTCATCCGCCTAGGAATGTTGCTAGCTTATTAGGTAATTGGCTAAGGGGGGTTCAACCTAAACTAAAAACTCAAGTCTTTGGAGGGGTCGCAGCGTTG

Reverse complement sequence

CAACGCTGCGACCCCTCCAAAGACTTGAGTTTTTAGTTTAGGTTGAACCCCCCTTAGCCAATTACCTAATAAGCTAGCAACATTCCTAGGCGGATGAATT[C/T]
CAAAAGAAATGAAGACAACATTCCACATAAATCGTGCAAGAGGACAATCAAAGAAAAGATGTTGTATTGATTCATTAGAATCACAAAAATAGCATTTAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 14.30% 0.25% 0.00% NA
All Indica  2759 75.80% 23.80% 0.40% 0.00% NA
All Japonica  1512 99.40% 0.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 62.90% 36.60% 0.50% 0.00% NA
Indica II  465 59.60% 39.60% 0.86% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 67.70% 31.80% 0.51% 0.00% NA
Temperate Japonica  767 99.20% 0.70% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216616004 G -> A LOC_Os02g28040.1 upstream_gene_variant ; 3766.0bp to feature; MODIFIER silent_mutation Average:46.27; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0216616004 G -> A LOC_Os02g28074.1 upstream_gene_variant ; 1407.0bp to feature; MODIFIER silent_mutation Average:46.27; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0216616004 G -> A LOC_Os02g28074.2 upstream_gene_variant ; 1374.0bp to feature; MODIFIER silent_mutation Average:46.27; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0216616004 G -> A LOC_Os02g28074.3 upstream_gene_variant ; 1407.0bp to feature; MODIFIER silent_mutation Average:46.27; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0216616004 G -> A LOC_Os02g28050.1 intron_variant ; MODIFIER silent_mutation Average:46.27; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216616004 NA 1.56E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 2.46E-07 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 1.67E-06 1.01E-12 mr1109 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 8.86E-07 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 8.14E-11 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 3.51E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 9.04E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 2.85E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 1.00E-07 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 5.45E-06 NA mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 1.44E-07 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 3.66E-10 2.52E-24 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 1.60E-07 4.40E-13 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 2.59E-08 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 6.07E-07 9.26E-12 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 5.32E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 6.49E-06 NA mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 2.69E-09 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 6.10E-07 NA mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 1.59E-06 1.11E-08 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 1.42E-10 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 9.36E-11 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 2.12E-09 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 4.28E-09 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 1.78E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 1.35E-11 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216616004 NA 1.07E-06 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251