Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216601743:

Variant ID: vg0216601743 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16601743
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TAAATTCGTCTCGCGGTTTACTGACAAATACTGTAATTAGTTTTTTTATTAGCGCCCGAATACCCCATGCAACACTCTATATAATACCCGATGTGACACG[C/T]
CAAAACTTTACACCCCTAGATGTAAACACCCTTAGCTAGGCATATATGCATATATTTTCTTAAATTAGTCGTTGATTGATCAACGCGTTTAAGCAAGCAT

Reverse complement sequence

ATGCTTGCTTAAACGCGTTGATCAATCAACGACTAATTTAAGAAAATATATGCATATATGCCTAGCTAAGGGTGTTTACATCTAGGGGTGTAAAGTTTTG[G/A]
CGTGTCACATCGGGTATTATATAGAGTGTTGCATGGGGTATTCGGGCGCTAATAAAAAAACTAATTACAGTATTTGTCAGTAAACCGCGAGACGAATTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.80% 0.06% 0.00% NA
All Indica  2759 52.70% 47.20% 0.07% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.07% 0.00% NA
Aus  269 58.00% 42.00% 0.00% 0.00% NA
Indica I  595 38.30% 61.70% 0.00% 0.00% NA
Indica II  465 27.50% 72.50% 0.00% 0.00% NA
Indica III  913 80.60% 19.40% 0.00% 0.00% NA
Indica Intermediate  786 46.20% 53.60% 0.25% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.00% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216601743 C -> T LOC_Os02g28030.1 upstream_gene_variant ; 3022.0bp to feature; MODIFIER silent_mutation Average:67.362; most accessible tissue: Minghui63 root, score: 92.39 N N N N
vg0216601743 C -> T LOC_Os02g28040.1 downstream_gene_variant ; 925.0bp to feature; MODIFIER silent_mutation Average:67.362; most accessible tissue: Minghui63 root, score: 92.39 N N N N
vg0216601743 C -> T LOC_Os02g28030-LOC_Os02g28040 intergenic_region ; MODIFIER silent_mutation Average:67.362; most accessible tissue: Minghui63 root, score: 92.39 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0216601743 C T 0.12 0.05 0.03 0.01 0.03 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216601743 NA 8.67E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 4.21E-07 NA mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 1.61E-07 1.13E-09 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 6.37E-06 1.42E-14 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 1.97E-06 1.97E-06 mr1379 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 1.07E-06 1.61E-16 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 NA 1.42E-07 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 1.14E-06 4.11E-07 mr1818 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 2.00E-10 3.17E-18 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 2.19E-10 4.05E-10 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 3.55E-07 NA mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 6.25E-07 5.35E-09 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 4.26E-07 8.50E-18 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 NA 6.42E-08 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 NA 2.79E-06 mr1409_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 6.79E-06 7.66E-15 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 NA 6.84E-08 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 NA 3.84E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 5.18E-07 5.23E-10 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 6.11E-07 2.37E-08 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 2.36E-10 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 2.57E-09 1.00E-08 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 3.87E-08 1.51E-12 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 7.26E-08 2.29E-08 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 6.82E-08 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 4.31E-08 9.07E-07 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 1.04E-07 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216601743 6.59E-07 1.70E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251