\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216594873:

Variant ID: vg0216594873 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16594873
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGACGCTATCAACCCCTCAACGGAGTATTCCTGTCTCTTGTATTTGAGTGCAGTACTGAAACCTCTCCAAGATGGAGGTTGTTTCGCGATAATGCACC[C/T]
GGCCACAAATTTGTCGGGTAAGACACACTTAAGGAGTTCGAGTTCCTTAGCCATGGTTTGTATCTCATGAGCCTGTTCGACTATAGAACAGTTGTCAGCC

Reverse complement sequence

GGCTGACAACTGTTCTATAGTCGAACAGGCTCATGAGATACAAACCATGGCTAAGGAACTCGAACTCCTTAAGTGTGTCTTACCCGACAAATTTGTGGCC[G/A]
GGTGCATTATCGCGAAACAACCTCCATCTTGGAGAGGTTTCAGTACTGCACTCAAATACAAGAGACAGGAATACTCCGTTGAGGGGTTGATAGCGTCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.00% 0.40% 5.95% 56.58% NA
All Indica  2759 15.00% 0.70% 9.39% 74.99% NA
All Japonica  1512 77.60% 0.00% 0.33% 22.09% NA
Aus  269 11.20% 0.70% 5.20% 82.90% NA
Indica I  595 9.40% 1.50% 4.54% 84.54% NA
Indica II  465 14.80% 0.90% 5.59% 78.71% NA
Indica III  913 20.70% 0.10% 15.66% 63.53% NA
Indica Intermediate  786 12.60% 0.50% 8.02% 78.88% NA
Temperate Japonica  767 95.80% 0.00% 0.00% 4.17% NA
Tropical Japonica  504 47.00% 0.00% 0.79% 52.18% NA
Japonica Intermediate  241 83.40% 0.00% 0.41% 16.18% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 45.60% 1.10% 3.33% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216594873 C -> T LOC_Os02g28020.1 missense_variant ; p.Gly117Arg; MODERATE nonsynonymous_codon ; G117R Average:43.292; most accessible tissue: Minghui63 young leaf, score: 70.655 benign 0.872 DELETERIOUS 0.02
vg0216594873 C -> DEL LOC_Os02g28020.1 N frameshift_variant Average:43.292; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216594873 NA 7.17E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 7.97E-07 NA mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 4.09E-08 9.58E-11 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 NA 9.84E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 NA 6.51E-13 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 NA 2.30E-06 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 4.44E-06 NA mr1610 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 2.77E-06 6.49E-07 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 7.24E-08 4.87E-18 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 1.20E-06 1.33E-09 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 NA 2.46E-07 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 1.84E-06 2.93E-16 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 NA 2.48E-08 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 2.66E-06 7.08E-15 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 NA 2.01E-09 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 NA 6.80E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 NA 3.73E-08 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594873 NA 5.99E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251