Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216594674:

Variant ID: vg0216594674 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16594674
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

GCCAGGTTGACCACACACAAAGCAAGTCCTCTCATCCTGATTAGGATTGTTGTTGTTCTTCTTCTTAAAGTTGGTGGTCTGCTGAGCTTTGTATTTCCCC[T/C]
TGCTCTTGTTCTGGGCCTTGTGCACAACATTGGCAGTGGACTGGCCACCATCGCCCTTAGACGCGACATCTTTTTCCCGAGCTTTCTCCTCAACATCAAG

Reverse complement sequence

CTTGATGTTGAGGAGAAAGCTCGGGAAAAAGATGTCGCGTCTAAGGGCGATGGTGGCCAGTCCACTGCCAATGTTGTGCACAAGGCCCAGAACAAGAGCA[A/G]
GGGGAAATACAAAGCTCAGCAGACCACCAACTTTAAGAAGAAGAACAACAACAATCCTAATCAGGATGAGAGGACTTGCTTTGTGTGTGGTCAACCTGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.50%	28.40%	1.08%	0.00%	NA
All Indica	2759	54.90%	43.30%	1.81%	0.00%	NA
All Japonica	1512	99.00%	1.00%	0.00%	0.00%	NA
Aus	269	58.40%	41.60%	0.00%	0.00%	NA
Indica I	595	39.80%	60.00%	0.17%	0.00%	NA
Indica II	465	29.70%	69.00%	1.29%	0.00%	NA
Indica III	913	83.80%	12.50%	3.72%	0.00%	NA
Indica Intermediate	786	47.60%	51.30%	1.15%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216594674	T -> C	LOC_Os02g28020.1	missense_variant ; p.Lys183Arg; MODERATE	nonsynonymous_codon ; K183R	Average:40.953; most accessible tissue: Minghui63 young leaf, score: 72.408	unknown	unknown	DELETERIOUS	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216594674	NA	3.31E-06	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	NA	5.41E-08	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	NA	5.13E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	NA	3.26E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	7.24E-07	1.55E-07	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	NA	7.60E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	4.70E-06	NA	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	8.48E-07	NA	mr1458_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	NA	1.79E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	NA	5.32E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	2.00E-06	1.12E-06	mr1729_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	NA	3.17E-06	mr1740_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	NA	5.99E-06	mr1741_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	NA	9.75E-06	mr1785_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	NA	1.74E-06	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	9.05E-06	NA	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	1.24E-06	3.17E-07	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	NA	7.43E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216594674	8.38E-07	4.08E-07	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251