| Variant ID: vg0216569039 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16569039 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.02, others allele: 0.00, population size: 245. )
ATTTATACATAGCAGGAGCAGCGTTCAAGCATTATTTGAATTGCATACACAACTTTAGGGATATAATGAGATGTATTGAAGATTAGTAGAAGAGAATTAA[T/G]
TACCATCACTTGTTCGTAACTAAAAGGAAAAATCGACCGCTAAAGTATCAACTATATTGCCAGATAATTTTGTTGTGTGGTGTATAAAACTTGTCTGAAA
TTTCAGACAAGTTTTATACACCACACAACAAAATTATCTGGCAATATAGTTGATACTTTAGCGGTCGATTTTTCCTTTTAGTTACGAACAAGTGATGGTA[A/C]
TTAATTCTCTTCTACTAATCTTCAATACATCTCATTATATCCCTAAAGTTGTGTATGCAATTCAAATAATGCTTGAACGCTGCTCCTGCTATGTATAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.30% | 45.60% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 42.80% | 56.90% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 74.60% | 25.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 42.40% | 57.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 23.70% | 76.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 44.30% | 55.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 61.70% | 38.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 34.60% | 65.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 39.30% | 60.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216569039 | T -> G | LOC_Os02g27980.1 | downstream_gene_variant ; 197.0bp to feature; MODIFIER | silent_mutation | Average:66.042; most accessible tissue: Callus, score: 81.158 | N | N | N | N |
| vg0216569039 | T -> G | LOC_Os02g27980-LOC_Os02g27990 | intergenic_region ; MODIFIER | silent_mutation | Average:66.042; most accessible tissue: Callus, score: 81.158 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216569039 | NA | 1.48E-06 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216569039 | NA | 3.12E-07 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216569039 | NA | 2.96E-11 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216569039 | NA | 1.67E-07 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216569039 | NA | 6.59E-16 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216569039 | NA | 2.28E-10 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216569039 | NA | 1.46E-09 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216569039 | NA | 1.29E-08 | mr1129 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216569039 | 2.65E-07 | NA | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216569039 | NA | 1.88E-07 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/