\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216547473:

Variant ID: vg0216547473 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 16547473
Reference Allele: TTGAlternative Allele: TGTGTGTG,TGTGTG,TGTGTGTGTG,TGTG,GTG,T
Primary Allele: TGTGTGTGSecondary Allele: TGTG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGGAGTCTAGAGTGGAGTTGTTAATCGCTCTGAACCCCAGCCTCACCCCTCTAGTTCATTTTTTCATAATACTCTAGCCCACTCCACTCTTTATTTCTT[TTG/TGTGTGTG,TGTGTG,TGTGTGTGTG,TGTG,GTG,T]
TGTGTGTGTGTGTGTGTTGCTAGAGGAACTATACATCGCACTGACACCCCCCCCTCTAGTTCATTTTTTTCAAATCACTCCAATCGGGAATGGGAATCCC

Reverse complement sequence

GGGATTCCCATTCCCGATTGGAGTGATTTGAAAAAAATGAACTAGAGGGGGGGGTGTCAGTGCGATGTATAGTTCCTCTAGCAACACACACACACACACA[CAA/CACACACA,CACACA,CACACACACA,CACA,CAC,A]
AAGAAATAAAGAGTGGAGTGGGCTAGAGTATTATGAAAAAATGAACTAGAGGGGTGAGGCTGGGGTTCAGAGCGATTAACAACTCCACTCTAGACTCCGC

Allele Frequencies:

Populations Population SizeFrequency of TGTGTGTG(primary allele) Frequency of TGTG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.40% 14.80% 16.91% 1.21% TTG: 14.03%; TGTGTG: 12.65%; T: 9.52%; TGTGTGTGTG: 7.30%; GTG: 6.18%
All Indica  2759 27.70% 19.10% 18.41% 0.11% TGTGTGTGTG: 11.74%; TGTGTG: 11.42%; GTG: 8.52%; T: 2.50%; TTG: 0.51%
All Japonica  1512 0.60% 4.90% 11.44% 1.59% TTG: 41.87%; T: 24.60%; TGTGTG: 12.83%; GTG: 1.85%; TGTGTGTGTG: 0.33%
Aus  269 15.20% 32.30% 13.01% 0.00% TGTGTG: 29.74%; GTG: 7.81%; TGTGTGTGTG: 1.86%
Indica I  595 23.40% 20.70% 31.76% 0.00% TGTGTGTGTG: 11.43%; TGTGTG: 7.39%; GTG: 5.38%
Indica II  465 8.80% 29.50% 13.76% 0.00% TGTGTGTGTG: 29.03%; T: 7.31%; GTG: 7.10%; TGTGTG: 2.80%; TTG: 1.72%
Indica III  913 39.80% 14.30% 7.89% 0.11% TGTGTG: 22.56%; GTG: 11.61%; T: 2.30%; TGTGTGTGTG: 0.99%; TTG: 0.44%
Indica Intermediate  786 28.10% 17.30% 23.28% 0.25% TGTGTGTGTG: 14.25%; GTG: 8.14%; TGTGTG: 6.62%; T: 1.78%; TTG: 0.25%
Temperate Japonica  767 0.00% 2.30% 8.47% 1.96% TTG: 66.88%; T: 19.17%; TGTGTG: 0.52%; TGTGTGTGTG: 0.39%; GTG: 0.26%
Tropical Japonica  504 1.60% 7.10% 15.08% 0.99% TGTGTG: 34.92%; T: 22.82%; TTG: 12.50%; GTG: 4.76%; TGTGTGTGTG: 0.20%
Japonica Intermediate  241 0.40% 8.30% 13.28% 1.66% T: 45.64%; TTG: 23.65%; TGTGTG: 5.81%; GTG: 0.83%; TGTGTGTGTG: 0.41%
VI/Aromatic  96 0.00% 2.10% 60.42% 27.08% GTG: 5.21%; TTG: 3.12%; T: 2.08%
Intermediate  90 10.00% 10.00% 27.78% 4.44% TTG: 14.44%; TGTGTGTGTG: 12.22%; TGTGTG: 10.00%; T: 7.78%; GTG: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216547473 TTG -> T LOC_Os02g27950.1 upstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> T LOC_Os02g27950.2 upstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> T LOC_Os02g27960.1 downstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> T LOC_Os02g27960.2 downstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> T LOC_Os02g27950-LOC_Os02g27960 intergenic_region ; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTGTGTG LOC_Os02g27950.1 upstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTGTGTG LOC_Os02g27950.2 upstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTGTGTG LOC_Os02g27960.1 downstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTGTGTG LOC_Os02g27960.2 downstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTGTGTG LOC_Os02g27950-LOC_Os02g27960 intergenic_region ; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTGTG LOC_Os02g27950.1 upstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTGTG LOC_Os02g27950.2 upstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTGTG LOC_Os02g27960.1 downstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTGTG LOC_Os02g27960.2 downstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTGTG LOC_Os02g27950-LOC_Os02g27960 intergenic_region ; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTG LOC_Os02g27950.1 upstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTG LOC_Os02g27950.2 upstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTG LOC_Os02g27960.1 downstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTG LOC_Os02g27960.2 downstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTG LOC_Os02g27950-LOC_Os02g27960 intergenic_region ; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> DEL N N silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTG LOC_Os02g27950.1 upstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTG LOC_Os02g27950.2 upstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTG LOC_Os02g27960.1 downstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTG LOC_Os02g27960.2 downstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> TGTGTG LOC_Os02g27950-LOC_Os02g27960 intergenic_region ; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> GTG LOC_Os02g27950.1 upstream_gene_variant ; 1727.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> GTG LOC_Os02g27950.2 upstream_gene_variant ; 1727.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> GTG LOC_Os02g27960.1 downstream_gene_variant ; 2709.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> GTG LOC_Os02g27960.2 downstream_gene_variant ; 2709.0bp to feature; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0216547473 TTG -> GTG LOC_Os02g27950-LOC_Os02g27960 intergenic_region ; MODIFIER silent_mutation Average:69.491; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216547473 4.59E-06 NA mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.68E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 6.12E-14 mr1089 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 4.28E-15 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 2.39E-09 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 3.69E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 5.30E-10 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.04E-09 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 4.64E-07 3.33E-16 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 6.72E-09 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 2.87E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 5.22E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.20E-17 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.37E-06 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.17E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 3.20E-06 2.76E-12 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 4.35E-07 1.24E-12 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 7.12E-06 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 9.80E-12 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.98E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.28E-10 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 7.69E-08 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.03E-10 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 5.78E-08 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.39E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.26E-06 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 1.64E-07 3.57E-09 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 8.53E-08 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 2.31E-09 8.32E-27 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 8.03E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 1.93E-06 5.34E-14 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 1.34E-07 2.00E-11 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.02E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 3.29E-08 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 1.41E-08 NA mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 3.10E-12 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.97E-13 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 3.46E-08 NA mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 6.47E-11 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 4.66E-14 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 3.14E-14 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 7.88E-08 7.67E-40 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 2.18E-06 5.36E-15 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 3.00E-07 NA mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.36E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 5.26E-12 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 2.80E-07 NA mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 9.45E-06 5.60E-09 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 2.82E-09 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 7.89E-07 6.18E-23 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 3.26E-07 2.14E-10 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.97E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 7.06E-09 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 3.02E-08 2.44E-44 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 4.04E-06 5.86E-13 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.80E-09 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 6.90E-06 8.49E-25 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.32E-09 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 1.99E-06 6.18E-26 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 2.44E-11 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 6.45E-08 1.16E-42 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 4.17E-06 6.24E-15 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 6.96E-09 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 8.45E-10 8.08E-16 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 9.45E-10 1.09E-19 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.36E-14 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.32E-07 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 3.05E-06 1.01E-32 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 7.86E-08 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 4.65E-09 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 3.24E-08 3.18E-44 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 4.90E-06 8.28E-13 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.68E-09 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.67E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 3.61E-08 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 4.45E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 9.11E-10 NA mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 2.42E-06 2.56E-15 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 8.16E-11 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 2.34E-08 3.67E-11 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 4.19E-07 3.30E-08 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 1.25E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 2.97E-10 5.67E-16 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 2.58E-09 1.24E-18 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 2.25E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 NA 2.24E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 1.25E-09 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 9.07E-09 6.48E-14 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 6.20E-10 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 5.14E-11 1.09E-29 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 6.63E-11 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 8.01E-12 4.46E-18 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 1.64E-09 1.09E-21 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 9.88E-11 5.99E-27 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 3.69E-12 5.59E-20 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216547473 8.03E-10 2.15E-22 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251