Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216528446:

Variant ID: vg0216528446 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16528446
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.07, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTATAGTTACACGCTCATCAATGAACTACTCCAATGATGGGAATGCAACCATACCTACACACAAGCAAGCAACAAACGTTCTATCCTACTAACTATTC[C/T]
TCAAAGACACTTTGGCGGCATAGGTTCTAAGGTAGGATCCAAACTTCATTCCATCTTGACCACTTGGCACTTCGGTCCTTCCTTGATCCACTTGACTGAT

Reverse complement sequence

ATCAGTCAAGTGGATCAAGGAAGGACCGAAGTGCCAAGTGGTCAAGATGGAATGAAGTTTGGATCCTACCTTAGAACCTATGCCGCCAAAGTGTCTTTGA[G/A]
GAATAGTTAGTAGGATAGAACGTTTGTTGCTTGCTTGTGTGTAGGTATGGTTGCATTCCCATCATTGGAGTAGTTCATTGATGAGCGTGTAACTATACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.00%	0.60%	55.27%	13.10%	NA
All Indica	2759	11.10%	0.50%	80.39%	8.08%	NA
All Japonica	1512	73.80%	0.50%	1.98%	23.74%	NA
Aus	269	3.30%	3.30%	85.13%	8.18%	NA
Indica I	595	1.50%	0.70%	82.18%	15.63%	NA
Indica II	465	13.10%	0.20%	80.65%	6.02%	NA
Indica III	913	18.70%	0.40%	76.34%	4.49%	NA
Indica Intermediate	786	8.10%	0.50%	83.59%	7.76%	NA
Temperate Japonica	767	95.70%	0.10%	0.65%	3.52%	NA
Tropical Japonica	504	37.90%	1.20%	2.98%	57.94%	NA
Japonica Intermediate	241	79.30%	0.00%	4.15%	16.60%	NA
VI/Aromatic	96	5.20%	1.00%	92.71%	1.04%	NA
Intermediate	90	33.30%	0.00%	51.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216528446	C -> T	LOC_Os02g27930.1	upstream_gene_variant ; 223.0bp to feature; MODIFIER	silent_mutation	Average:47.311; most accessible tissue: Minghui63 young leaf, score: 84.596	N	N	N	N
vg0216528446	C -> T	LOC_Os02g27940.1	upstream_gene_variant ; 2303.0bp to feature; MODIFIER	silent_mutation	Average:47.311; most accessible tissue: Minghui63 young leaf, score: 84.596	N	N	N	N
vg0216528446	C -> T	LOC_Os02g27920.1	downstream_gene_variant ; 2585.0bp to feature; MODIFIER	silent_mutation	Average:47.311; most accessible tissue: Minghui63 young leaf, score: 84.596	N	N	N	N
vg0216528446	C -> T	LOC_Os02g27930-LOC_Os02g27940	intergenic_region ; MODIFIER	silent_mutation	Average:47.311; most accessible tissue: Minghui63 young leaf, score: 84.596	N	N	N	N
vg0216528446	C -> DEL	N	N	silent_mutation	Average:47.311; most accessible tissue: Minghui63 young leaf, score: 84.596	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216528446	NA	3.97E-11	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	9.28E-08	2.79E-49	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	4.17E-07	1.92E-17	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	1.43E-09	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	2.87E-06	8.90E-41	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	4.68E-07	3.63E-16	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	2.19E-12	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	2.74E-10	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	2.08E-06	7.10E-10	mr1257	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	8.26E-11	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	3.79E-14	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	1.56E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	6.33E-30	mr1423	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	7.18E-07	1.06E-14	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	1.66E-06	6.38E-15	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	1.44E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	8.59E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	1.07E-10	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	2.33E-07	mr1603	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	3.68E-08	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	2.42E-08	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	5.27E-07	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	1.14E-11	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	9.42E-15	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	7.97E-06	5.68E-06	mr1102_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	2.88E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	3.42E-06	3.72E-06	mr1154_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	4.84E-06	NA	mr1207_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	3.27E-07	2.51E-07	mr1223_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	8.74E-11	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	1.11E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	1.17E-08	mr1251_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	4.69E-09	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	4.65E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	2.52E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	4.10E-08	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	1.27E-08	mr1435_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	5.48E-09	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	2.03E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446	NA	4.07E-06	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251