\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216528446:

Variant ID: vg0216528446 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16528446
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.07, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTATAGTTACACGCTCATCAATGAACTACTCCAATGATGGGAATGCAACCATACCTACACACAAGCAAGCAACAAACGTTCTATCCTACTAACTATTC[C/T]
TCAAAGACACTTTGGCGGCATAGGTTCTAAGGTAGGATCCAAACTTCATTCCATCTTGACCACTTGGCACTTCGGTCCTTCCTTGATCCACTTGACTGAT

Reverse complement sequence

ATCAGTCAAGTGGATCAAGGAAGGACCGAAGTGCCAAGTGGTCAAGATGGAATGAAGTTTGGATCCTACCTTAGAACCTATGCCGCCAAAGTGTCTTTGA[G/A]
GAATAGTTAGTAGGATAGAACGTTTGTTGCTTGCTTGTGTGTAGGTATGGTTGCATTCCCATCATTGGAGTAGTTCATTGATGAGCGTGTAACTATACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.00% 0.60% 55.27% 13.10% NA
All Indica  2759 11.10% 0.50% 80.39% 8.08% NA
All Japonica  1512 73.80% 0.50% 1.98% 23.74% NA
Aus  269 3.30% 3.30% 85.13% 8.18% NA
Indica I  595 1.50% 0.70% 82.18% 15.63% NA
Indica II  465 13.10% 0.20% 80.65% 6.02% NA
Indica III  913 18.70% 0.40% 76.34% 4.49% NA
Indica Intermediate  786 8.10% 0.50% 83.59% 7.76% NA
Temperate Japonica  767 95.70% 0.10% 0.65% 3.52% NA
Tropical Japonica  504 37.90% 1.20% 2.98% 57.94% NA
Japonica Intermediate  241 79.30% 0.00% 4.15% 16.60% NA
VI/Aromatic  96 5.20% 1.00% 92.71% 1.04% NA
Intermediate  90 33.30% 0.00% 51.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216528446 C -> T LOC_Os02g27930.1 upstream_gene_variant ; 223.0bp to feature; MODIFIER silent_mutation Average:47.311; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0216528446 C -> T LOC_Os02g27940.1 upstream_gene_variant ; 2303.0bp to feature; MODIFIER silent_mutation Average:47.311; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0216528446 C -> T LOC_Os02g27920.1 downstream_gene_variant ; 2585.0bp to feature; MODIFIER silent_mutation Average:47.311; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0216528446 C -> T LOC_Os02g27930-LOC_Os02g27940 intergenic_region ; MODIFIER silent_mutation Average:47.311; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0216528446 C -> DEL N N silent_mutation Average:47.311; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216528446 NA 3.97E-11 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 9.28E-08 2.79E-49 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 4.17E-07 1.92E-17 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 1.43E-09 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 2.87E-06 8.90E-41 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 4.68E-07 3.63E-16 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 2.19E-12 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 2.74E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 2.08E-06 7.10E-10 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 8.26E-11 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 3.79E-14 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 1.56E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 6.33E-30 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 7.18E-07 1.06E-14 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 1.66E-06 6.38E-15 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 1.44E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 8.59E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 1.07E-10 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 2.33E-07 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 3.68E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 2.42E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 5.27E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 1.14E-11 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 9.42E-15 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 7.97E-06 5.68E-06 mr1102_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 2.88E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 3.42E-06 3.72E-06 mr1154_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 4.84E-06 NA mr1207_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 3.27E-07 2.51E-07 mr1223_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 8.74E-11 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 1.11E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 1.17E-08 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 4.69E-09 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 4.65E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 2.52E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 4.10E-08 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 1.27E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 5.48E-09 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 2.03E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216528446 NA 4.07E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251