\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216502492:

Variant ID: vg0216502492 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 16502492
Reference Allele: AAlternative Allele: G,AG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGAGGTGGGTAATTTTTCCCCAAAAGCATGTGAAAGCAGGAGGTAGAGGTGGTTTTGATTTGTACCACACCAAAAGCTAGCTTTGGGCAAAAGCAGCT[A/G,AG]
TGGCTTTTGGGCCCTTTGGTTGGCTTCTAGCTTTTGCAAAAGCAAAAGCAGGTTGAAAAGCCCAACCAAACACACTCTAACTAGTGATTGTTGATCTCTA

Reverse complement sequence

TAGAGATCAACAATCACTAGTTAGAGTGTGTTTGGTTGGGCTTTTCAACCTGCTTTTGCTTTTGCAAAAGCTAGAAGCCAACCAAAGGGCCCAAAAGCCA[T/C,CT]
AGCTGCTTTTGCCCAAAGCTAGCTTTTGGTGTGGTACAAATCAAAACCACCTCTACCTCCTGCTTTCACATGCTTTTGGGGAAAAATTACCCACCTCAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 10.90% 1.33% 0.00% AG: 0.02%
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 62.60% 33.30% 4.03% 0.00% AG: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 30.80% 62.70% 6.39% 0.00% AG: 0.13%
Tropical Japonica  504 99.00% 0.40% 0.60% 0.00% NA
Japonica Intermediate  241 87.60% 8.70% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216502492 A -> G LOC_Os02g27870.1 upstream_gene_variant ; 271.0bp to feature; MODIFIER silent_mutation Average:93.398; most accessible tissue: Zhenshan97 panicle, score: 94.74 N N N N
vg0216502492 A -> G LOC_Os02g27870.2 upstream_gene_variant ; 1367.0bp to feature; MODIFIER silent_mutation Average:93.398; most accessible tissue: Zhenshan97 panicle, score: 94.74 N N N N
vg0216502492 A -> G LOC_Os02g27880.1 intron_variant ; MODIFIER silent_mutation Average:93.398; most accessible tissue: Zhenshan97 panicle, score: 94.74 N N N N
vg0216502492 A -> AG LOC_Os02g27870.1 upstream_gene_variant ; 272.0bp to feature; MODIFIER silent_mutation Average:93.398; most accessible tissue: Zhenshan97 panicle, score: 94.74 N N N N
vg0216502492 A -> AG LOC_Os02g27870.2 upstream_gene_variant ; 1368.0bp to feature; MODIFIER silent_mutation Average:93.398; most accessible tissue: Zhenshan97 panicle, score: 94.74 N N N N
vg0216502492 A -> AG LOC_Os02g27880.1 intron_variant ; MODIFIER silent_mutation Average:93.398; most accessible tissue: Zhenshan97 panicle, score: 94.74 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0216502492 A AG 0.06 0.04 0.03 0.05 0.07 0.06
vg0216502492 A G 0.07 0.03 0.03 0.05 0.08 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216502492 NA 6.33E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0216502492 2.82E-07 1.10E-31 mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216502492 NA 1.18E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216502492 NA 8.03E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216502492 7.50E-08 2.95E-28 mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216502492 NA 3.15E-11 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216502492 NA 3.24E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216502492 NA 2.11E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216502492 NA 4.73E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216502492 NA 3.13E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216502492 NA 6.17E-06 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251