RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0216462713:

Variant ID: vg0216462713 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16462713
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGAGTAGGCTCCTAGAAACCATAGCCTGTACGCCGAACTGAAAGAGTAGGCAGCATTGGCCGTCAGCTTCTAGACGATGGAGTTCTTCTGGTCGGTTA[A/G]
AGGGCCAACACGTTGAATCGTGGTCCATAGACAAATGTACCGGTGCGGTGGTCCGCCTCTGTGTACTTGGAAGGTCGATATACCGGATCCAGACTTAAGG

Reverse complement sequence

CCTTAAGTCTGGATCCGGTATATCGACCTTCCAAGTACACAGAGGCGGACCACCGCACCGGTACATTTGTCTATGGACCACGATTCAACGTGTTGGCCCT[T/C]
TAACCGACCAGAAGAACTCCATCGTCTAGAAGCTGACGGCCAATGCTGCCTACTCTTTCAGTTCGGCGTACAGGCTATGGTTTCTAGGAGCCTACTCTTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.30%	38.20%	0.44%	0.04%	NA
All Indica	2759	78.80%	20.60%	0.54%	0.04%	NA
All Japonica	1512	26.30%	73.30%	0.33%	0.07%	NA
Aus	269	65.80%	33.80%	0.37%	0.00%	NA
Indica I	595	77.80%	21.50%	0.67%	0.00%	NA
Indica II	465	62.40%	37.20%	0.43%	0.00%	NA
Indica III	913	86.50%	13.10%	0.33%	0.00%	NA
Indica Intermediate	786	80.30%	18.80%	0.76%	0.13%	NA
Temperate Japonica	767	4.70%	95.00%	0.26%	0.00%	NA
Tropical Japonica	504	61.90%	37.70%	0.20%	0.20%	NA
Japonica Intermediate	241	20.30%	78.80%	0.83%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	67.80%	32.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216462713	A -> G	LOC_Os02g27810.1	downstream_gene_variant ; 2967.0bp to feature; MODIFIER	silent_mutation	Average:64.631; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0216462713	A -> G	LOC_Os02g27800-LOC_Os02g27810	intergenic_region ; MODIFIER	silent_mutation	Average:64.631; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0216462713	A -> DEL	N	N	silent_mutation	Average:64.631; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216462713	NA	7.06E-06	mr1039	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216462713	4.03E-08	NA	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216462713	7.29E-07	6.06E-10	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216462713	NA	1.69E-10	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216462713	8.42E-09	1.39E-42	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216462713	NA	1.12E-08	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216462713	6.14E-06	2.10E-16	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216462713	2.62E-07	NA	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216462713	2.45E-06	4.53E-14	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216462713	1.37E-08	3.74E-35	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 141 entries

Previous1 2 3 4 5…15Next

Search for Variation information by Variation ID:

Detailed information for vg0216462713:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact