Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216448432:

Variant ID: vg0216448432 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16448432
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


TATATGTTGCTAAAATTTTTCTATAAACTTGGTCAAACTTAACAAAGATTGACTAGGAAAAAAGTTAAACGGCTTATAATATGAAATAGAGGGAGTAACT[T/C]
ATTAATGGAATTCTTTTCTTTTTCATATTTTAAAAAAGGAAAAAGTATGAATTATCCCGAATTATCGCGGTCGACTGAATTATCCTCCCAAAATCGAAAA

Reverse complement sequence

TTTTCGATTTTGGGAGGATAATTCAGTCGACCGCGATAATTCGGGATAATTCATACTTTTTCCTTTTTTAAAATATGAAAAAGAAAAGAATTCCATTAAT[A/G]
AGTTACTCCCTCTATTTCATATTATAAGCCGTTTAACTTTTTTCCTAGTCAATCTTTGTTAAGTTTGACCAAGTTTATAGAAAAATTTTAGCAACATATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 7.90% 2.39% 0.00% NA
All Indica  2759 82.50% 13.50% 4.02% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 63.40% 26.20% 10.42% 0.00% NA
Indica II  465 88.00% 11.20% 0.86% 0.00% NA
Indica III  913 98.90% 0.70% 0.44% 0.00% NA
Indica Intermediate  786 74.70% 20.10% 5.22% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216448432 T -> C LOC_Os02g27790.1 upstream_gene_variant ; 1104.0bp to feature; MODIFIER silent_mutation Average:51.184; most accessible tissue: Callus, score: 65.046 N N N N
vg0216448432 T -> C LOC_Os02g27769.1 downstream_gene_variant ; 2202.0bp to feature; MODIFIER silent_mutation Average:51.184; most accessible tissue: Callus, score: 65.046 N N N N
vg0216448432 T -> C LOC_Os02g27780.1 downstream_gene_variant ; 545.0bp to feature; MODIFIER silent_mutation Average:51.184; most accessible tissue: Callus, score: 65.046 N N N N
vg0216448432 T -> C LOC_Os02g27769-LOC_Os02g27780 intergenic_region ; MODIFIER silent_mutation Average:51.184; most accessible tissue: Callus, score: 65.046 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216448432 NA 8.04E-08 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 1.31E-08 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 4.62E-08 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 4.65E-07 4.46E-16 mr1109 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 5.03E-10 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 6.10E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 1.05E-09 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 8.99E-10 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 1.93E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 3.95E-08 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 2.53E-09 2.15E-23 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 8.13E-08 4.41E-13 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 4.37E-07 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 1.06E-06 4.61E-12 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 2.81E-08 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 3.76E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 6.31E-09 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 1.03E-16 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 1.70E-06 NA mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 3.11E-16 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 2.43E-07 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 2.04E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 2.33E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 1.35E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 1.33E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 1.30E-22 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 7.08E-13 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 7.84E-14 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 4.93E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 1.35E-09 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216448432 NA 5.16E-11 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251