Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216409820:

Variant ID: vg0216409820 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16409820
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAACTCCCTCGAGATCAGTTTTCGTATAAGACATGGTATGTGGTGGATCCTGCCGAGATTTAGTCAACTACTATTAGGTCGCGCTTGTGGATCGCGCG[C/T]
GTCCTCCCGTCGGCGTCGCGTGTGGATTGGGATTTGGGAGTCCTCCCGCCGACGGTGGAACACCCCAGACCCTCTCTGCATTCATCTATATGTGTTGTGT

Reverse complement sequence

ACACAACACATATAGATGAATGCAGAGAGGGTCTGGGGTGTTCCACCGTCGGCGGGAGGACTCCCAAATCCCAATCCACACGCGACGCCGACGGGAGGAC[G/A]
CGCGCGATCCACAAGCGCGACCTAATAGTAGTTGACTAAATCTCGGCAGGATCCACCACATACCATGTCTTATACGAAAACTGATCTCGAGGGAGTTCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 33.70% 0.13% 0.00% NA
All Indica  2759 45.60% 54.30% 0.11% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 72.10% 27.50% 0.37% 0.00% NA
Indica I  595 25.70% 74.10% 0.17% 0.00% NA
Indica II  465 74.40% 25.60% 0.00% 0.00% NA
Indica III  913 47.90% 52.00% 0.11% 0.00% NA
Indica Intermediate  786 41.10% 58.80% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216409820 C -> T LOC_Os02g27700.1 upstream_gene_variant ; 65.0bp to feature; MODIFIER silent_mutation Average:67.449; most accessible tissue: Zhenshan97 flower, score: 74.459 N N N N
vg0216409820 C -> T LOC_Os02g27710.1 upstream_gene_variant ; 3087.0bp to feature; MODIFIER silent_mutation Average:67.449; most accessible tissue: Zhenshan97 flower, score: 74.459 N N N N
vg0216409820 C -> T LOC_Os02g27680.1 downstream_gene_variant ; 4547.0bp to feature; MODIFIER silent_mutation Average:67.449; most accessible tissue: Zhenshan97 flower, score: 74.459 N N N N
vg0216409820 C -> T LOC_Os02g27690.1 downstream_gene_variant ; 1708.0bp to feature; MODIFIER silent_mutation Average:67.449; most accessible tissue: Zhenshan97 flower, score: 74.459 N N N N
vg0216409820 C -> T LOC_Os02g27700-LOC_Os02g27710 intergenic_region ; MODIFIER silent_mutation Average:67.449; most accessible tissue: Zhenshan97 flower, score: 74.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216409820 NA 3.88E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 1.31E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 9.45E-06 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 4.34E-09 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 8.31E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 1.36E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 8.03E-08 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 2.74E-07 7.51E-13 mr1855 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 5.36E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 3.95E-06 3.20E-15 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 1.06E-07 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 1.02E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 1.21E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 9.73E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 9.48E-06 mr1137_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 NA 1.08E-10 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 9.72E-06 5.36E-10 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 4.38E-07 8.82E-12 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 7.49E-08 6.63E-13 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 2.28E-06 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 2.05E-06 4.62E-08 mr1818_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 7.65E-11 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 4.39E-09 4.84E-15 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 6.29E-08 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 1.01E-07 2.16E-11 mr1897_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 5.25E-08 1.66E-16 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 1.18E-07 5.42E-14 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 2.01E-08 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216409820 2.48E-07 1.55E-12 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251