\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216394881:

Variant ID: vg0216394881 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16394881
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGCCGTGCCGGCCCAATGGCTGCTGGGCCGTGCCCAGCCGTGCCTGGGCCGGGCCGTGCCGGGCGGGCCCTTTGGCCATCTATACCCACAATGCTTAA[C/A]
TGCTGGGCAGTTAGGTCGAGCAAGAGACCAAATTATCGGGACTATCTACAAATCATTCGCCATAAAATGAACCCAAATGTAGTCGGATTTTTCTCTACTG

Reverse complement sequence

CAGTAGAGAAAAATCCGACTACATTTGGGTTCATTTTATGGCGAATGATTTGTAGATAGTCCCGATAATTTGGTCTCTTGCTCGACCTAACTGCCCAGCA[G/T]
TTAAGCATTGTGGGTATAGATGGCCAAAGGGCCCGCCCGGCACGGCCCGGCCCAGGCACGGCTGGGCACGGCCCAGCAGCCATTGGGCCGGCACGGCCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 33.40% 0.19% 0.00% NA
All Indica  2759 45.60% 54.10% 0.29% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 74.30% 25.30% 0.37% 0.00% NA
Indica I  595 25.90% 73.90% 0.17% 0.00% NA
Indica II  465 74.20% 25.60% 0.22% 0.00% NA
Indica III  913 48.00% 51.70% 0.33% 0.00% NA
Indica Intermediate  786 41.00% 58.70% 0.38% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216394881 C -> A LOC_Os02g27660.1 upstream_gene_variant ; 3837.0bp to feature; MODIFIER silent_mutation Average:84.379; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0216394881 C -> A LOC_Os02g27674.1 downstream_gene_variant ; 2811.0bp to feature; MODIFIER silent_mutation Average:84.379; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0216394881 C -> A LOC_Os02g27674.2 downstream_gene_variant ; 2811.0bp to feature; MODIFIER silent_mutation Average:84.379; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0216394881 C -> A LOC_Os02g27660-LOC_Os02g27674 intergenic_region ; MODIFIER silent_mutation Average:84.379; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0216394881 C A -0.09 -0.09 -0.08 -0.06 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216394881 NA 3.33E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 NA 2.98E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 NA 5.65E-09 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 NA 9.19E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 NA 1.38E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 1.21E-07 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 5.62E-07 2.38E-12 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 NA 6.59E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 1.05E-06 1.24E-15 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 3.20E-06 3.79E-08 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 NA 1.04E-09 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 NA 4.72E-07 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 NA 9.66E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 NA 1.90E-10 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 NA 1.37E-09 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 1.48E-06 2.87E-11 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 4.18E-07 4.73E-12 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 3.58E-06 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 4.36E-06 8.34E-08 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 5.61E-11 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 3.45E-09 6.47E-15 mr1855_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 1.11E-07 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 2.91E-07 7.67E-11 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 1.09E-07 5.15E-16 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 4.20E-07 2.80E-13 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 5.20E-08 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216394881 8.92E-07 6.69E-12 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251