RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0216372724:

Variant ID: vg0216372724 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16372724
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.13, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TACTCCTGTCCGGGGATTGATCCGCCGAGTGTATTATTGATCGTATGATCTGGGAGAAAATCGTATCCCTAGAGGGAGCCGGACCCCTCCTTATATAGGG[G/A]
AAGGGGTCCATATTACAAAATACAGTCCATATCCCTAACGGAATATGTGATTATAGATAAAATACAATCGTAACCGATTAGGATCCCGGGTATTTCCTTG

Reverse complement sequence

CAAGGAAATACCCGGGATCCTAATCGGTTACGATTGTATTTTATCTATAATCACATATTCCGTTAGGGATATGGACTGTATTTTGTAATATGGACCCCTT[C/T]
CCCTATATAAGGAGGGGTCCGGCTCCCTCTAGGGATACGATTTTCTCCCAGATCATACGATCAATAATACACTCGGCGGATCAATCCCCGGACAGGAGTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	49.70%	0.28%	0.00%	NA
All Indica	2759	22.40%	77.20%	0.40%	0.00%	NA
All Japonica	1512	99.00%	0.90%	0.07%	0.00%	NA
Aus	269	33.80%	65.80%	0.37%	0.00%	NA
Indica I	595	21.80%	77.80%	0.34%	0.00%	NA
Indica II	465	39.10%	60.40%	0.43%	0.00%	NA
Indica III	913	15.90%	84.00%	0.11%	0.00%	NA
Indica Intermediate	786	20.60%	78.60%	0.76%	0.00%	NA
Temperate Japonica	767	98.80%	1.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216372724	G -> A	LOC_Os02g27630.1	upstream_gene_variant ; 1259.0bp to feature; MODIFIER	silent_mutation	Average:54.21; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N
vg0216372724	G -> A	LOC_Os02g27640.1	downstream_gene_variant ; 4513.0bp to feature; MODIFIER	silent_mutation	Average:54.21; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N
vg0216372724	G -> A	LOC_Os02g27620-LOC_Os02g27630	intergenic_region ; MODIFIER	silent_mutation	Average:54.21; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216372724	NA	2.34E-08	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216372724	NA	3.28E-07	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216372724	NA	2.93E-11	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216372724	8.92E-06	2.73E-12	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216372724	NA	7.06E-08	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216372724	NA	1.89E-08	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216372724	7.13E-06	2.38E-09	mr1253	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216372724	NA	3.08E-18	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216372724	NA	7.52E-09	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216372724	NA	8.81E-08	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 75 entries

Previous1 2 3 4 5…8Next

Search for Variation information by Variation ID:

Detailed information for vg0216372724:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact