Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216353266:

Variant ID: vg0216353266 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16353266
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, C: 0.41, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGATAATTTGTAGCTAGTAGTTGGCTATACTACTAAACATGCTCTAATCATGTAATAAAACATACTATACTATGTCGAGTCAGTGTTCCTTGGGTGAT[G/C]
ATCGATACAAATGTAATTAGCGAGCTAGAAATACAGAGCACTAAACTTTTCTTAATTTTGTTAGCTTAGTTATTACTGAGCTTGACTACTTGTTCTTTGG

Reverse complement sequence

CCAAAGAACAAGTAGTCAAGCTCAGTAATAACTAAGCTAACAAAATTAAGAAAAGTTTAGTGCTCTGTATTTCTAGCTCGCTAATTACATTTGTATCGAT[C/G]
ATCACCCAAGGAACACTGACTCGACATAGTATAGTATGTTTTATTACATGATTAGAGCATGTTTAGTAGTATAGCCAACTACTAGCTACAAATTATCTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.00%	24.20%	0.55%	40.29%	NA
All Indica	2759	4.30%	33.70%	0.76%	61.22%	NA
All Japonica	1512	98.20%	0.90%	0.07%	0.79%	NA
Aus	269	0.70%	32.70%	0.74%	65.80%	NA
Indica I	595	1.20%	22.50%	0.67%	75.63%	NA
Indica II	465	11.40%	33.10%	1.72%	53.76%	NA
Indica III	913	3.10%	45.00%	0.33%	51.59%	NA
Indica Intermediate	786	3.80%	29.50%	0.76%	65.90%	NA
Temperate Japonica	767	99.00%	0.10%	0.00%	0.91%	NA
Tropical Japonica	504	98.20%	1.20%	0.20%	0.40%	NA
Japonica Intermediate	241	95.90%	2.90%	0.00%	1.24%	NA
VI/Aromatic	96	11.50%	85.40%	0.00%	3.12%	NA
Intermediate	90	41.10%	31.10%	2.22%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216353266	G -> DEL	N	N	silent_mutation	Average:44.074; most accessible tissue: Callus, score: 74.067	N	N	N	N
vg0216353266	G -> C	LOC_Os02g27594.1	upstream_gene_variant ; 3000.0bp to feature; MODIFIER	silent_mutation	Average:44.074; most accessible tissue: Callus, score: 74.067	N	N	N	N
vg0216353266	G -> C	LOC_Os02g27600.1	upstream_gene_variant ; 2831.0bp to feature; MODIFIER	silent_mutation	Average:44.074; most accessible tissue: Callus, score: 74.067	N	N	N	N
vg0216353266	G -> C	LOC_Os02g27594.2	upstream_gene_variant ; 3000.0bp to feature; MODIFIER	silent_mutation	Average:44.074; most accessible tissue: Callus, score: 74.067	N	N	N	N
vg0216353266	G -> C	LOC_Os02g27594.3	upstream_gene_variant ; 3000.0bp to feature; MODIFIER	silent_mutation	Average:44.074; most accessible tissue: Callus, score: 74.067	N	N	N	N
vg0216353266	G -> C	LOC_Os02g27594-LOC_Os02g27600	intergenic_region ; MODIFIER	silent_mutation	Average:44.074; most accessible tissue: Callus, score: 74.067	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216353266	NA	4.70E-07	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	5.21E-07	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	6.90E-06	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	8.79E-18	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	5.93E-12	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	1.06E-08	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	2.55E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	4.07E-06	4.70E-10	mr1608_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	2.82E-06	8.12E-11	mr1608_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	1.11E-07	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	1.78E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	1.68E-06	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	4.21E-12	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	4.57E-07	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	7.13E-11	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216353266	NA	3.91E-10	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251