\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216351821:

Variant ID: vg0216351821 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16351821
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.58, C: 0.43, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATATTTAAATTTACTTTCATATGATTATAATTTTGTTGCTACAAATCTTATAGTATATGAGAAATTATAAGTTAAAGATTAGTTTTGGAGACCGTGC[T/C]
ATCTTTGACCGCGCCTTATATTATAGGATAGAGGGAGTATATTTTTCTAGAAATGCATTATATATATCCATGACGTTTGCTTTGTGCCCCTTATAACAAA

Reverse complement sequence

TTTGTTATAAGGGGCACAAAGCAAACGTCATGGATATATATAATGCATTTCTAGAAAAATATACTCCCTCTATCCTATAATATAAGGCGCGGTCAAAGAT[A/G]
GCACGGTCTCCAAAACTAATCTTTAACTTATAATTTCTCATATACTATAAGATTTGTAGCAACAAAATTATAATCATATGAAAGTAAATTTAAATATCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.80% 26.30% 7.09% 31.85% NA
All Indica  2759 3.80% 37.50% 11.82% 46.86% NA
All Japonica  1512 98.30% 0.90% 0.13% 0.73% NA
Aus  269 0.70% 32.70% 0.74% 65.80% NA
Indica I  595 0.50% 25.70% 16.30% 57.48% NA
Indica II  465 11.00% 38.50% 15.48% 35.05% NA
Indica III  913 2.80% 48.30% 6.24% 42.61% NA
Indica Intermediate  786 3.30% 33.20% 12.72% 50.76% NA
Temperate Japonica  767 99.10% 0.00% 0.26% 0.65% NA
Tropical Japonica  504 98.20% 1.20% 0.00% 0.60% NA
Japonica Intermediate  241 95.90% 2.90% 0.00% 1.24% NA
VI/Aromatic  96 11.50% 84.40% 1.04% 3.12% NA
Intermediate  90 43.30% 28.90% 4.44% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216351821 T -> DEL N N silent_mutation Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 N N N N
vg0216351821 T -> C LOC_Os02g27594.1 upstream_gene_variant ; 1555.0bp to feature; MODIFIER silent_mutation Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 N N N N
vg0216351821 T -> C LOC_Os02g27600.1 upstream_gene_variant ; 4276.0bp to feature; MODIFIER silent_mutation Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 N N N N
vg0216351821 T -> C LOC_Os02g27594.2 upstream_gene_variant ; 1555.0bp to feature; MODIFIER silent_mutation Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 N N N N
vg0216351821 T -> C LOC_Os02g27594.3 upstream_gene_variant ; 1555.0bp to feature; MODIFIER silent_mutation Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 N N N N
vg0216351821 T -> C LOC_Os02g27594-LOC_Os02g27600 intergenic_region ; MODIFIER silent_mutation Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216351821 NA 2.17E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351821 NA 3.92E-07 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351821 NA 9.78E-06 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351821 NA 8.28E-30 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351821 NA 8.51E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351821 NA 3.06E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351821 7.81E-07 3.96E-09 mr1408 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351821 NA 3.89E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351821 NA 3.19E-29 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351821 NA 1.20E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351821 NA 3.59E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251