\
| Variant ID: vg0216351821 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16351821 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.58, C: 0.43, others allele: 0.00, population size: 86. )
TTGATATTTAAATTTACTTTCATATGATTATAATTTTGTTGCTACAAATCTTATAGTATATGAGAAATTATAAGTTAAAGATTAGTTTTGGAGACCGTGC[T/C]
ATCTTTGACCGCGCCTTATATTATAGGATAGAGGGAGTATATTTTTCTAGAAATGCATTATATATATCCATGACGTTTGCTTTGTGCCCCTTATAACAAA
TTTGTTATAAGGGGCACAAAGCAAACGTCATGGATATATATAATGCATTTCTAGAAAAATATACTCCCTCTATCCTATAATATAAGGCGCGGTCAAAGAT[A/G]
GCACGGTCTCCAAAACTAATCTTTAACTTATAATTTCTCATATACTATAAGATTTGTAGCAACAAAATTATAATCATATGAAAGTAAATTTAAATATCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.80% | 26.30% | 7.09% | 31.85% | NA |
| All Indica | 2759 | 3.80% | 37.50% | 11.82% | 46.86% | NA |
| All Japonica | 1512 | 98.30% | 0.90% | 0.13% | 0.73% | NA |
| Aus | 269 | 0.70% | 32.70% | 0.74% | 65.80% | NA |
| Indica I | 595 | 0.50% | 25.70% | 16.30% | 57.48% | NA |
| Indica II | 465 | 11.00% | 38.50% | 15.48% | 35.05% | NA |
| Indica III | 913 | 2.80% | 48.30% | 6.24% | 42.61% | NA |
| Indica Intermediate | 786 | 3.30% | 33.20% | 12.72% | 50.76% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.26% | 0.65% | NA |
| Tropical Japonica | 504 | 98.20% | 1.20% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 95.90% | 2.90% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 11.50% | 84.40% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 43.30% | 28.90% | 4.44% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216351821 | T -> DEL | N | N | silent_mutation | Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 | N | N | N | N |
| vg0216351821 | T -> C | LOC_Os02g27594.1 | upstream_gene_variant ; 1555.0bp to feature; MODIFIER | silent_mutation | Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 | N | N | N | N |
| vg0216351821 | T -> C | LOC_Os02g27600.1 | upstream_gene_variant ; 4276.0bp to feature; MODIFIER | silent_mutation | Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 | N | N | N | N |
| vg0216351821 | T -> C | LOC_Os02g27594.2 | upstream_gene_variant ; 1555.0bp to feature; MODIFIER | silent_mutation | Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 | N | N | N | N |
| vg0216351821 | T -> C | LOC_Os02g27594.3 | upstream_gene_variant ; 1555.0bp to feature; MODIFIER | silent_mutation | Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 | N | N | N | N |
| vg0216351821 | T -> C | LOC_Os02g27594-LOC_Os02g27600 | intergenic_region ; MODIFIER | silent_mutation | Average:45.444; most accessible tissue: Minghui63 root, score: 85.142 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216351821 | NA | 2.17E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216351821 | NA | 3.92E-07 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216351821 | NA | 9.78E-06 | mr1085 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216351821 | NA | 8.28E-30 | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216351821 | NA | 8.51E-06 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216351821 | NA | 3.06E-08 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216351821 | 7.81E-07 | 3.96E-09 | mr1408 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216351821 | NA | 3.89E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216351821 | NA | 3.19E-29 | mr1546 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216351821 | NA | 1.20E-12 | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216351821 | NA | 3.59E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |