\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216350616:

Variant ID: vg0216350616 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16350616
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


GTATTGCTACTTTTCACAAATAAGTTCATTTGGACAATTCAAATTTTGAATTTTCAAAATTTGATAACTTCGAACAAAAATTGAGGTTAATAAATGATTT[T/C]
AAATAGAAAAGTCACCAAAATAAAAATTGTAGAACACATTGTTATGCAAAATTTTTATTTTGGTCATTTCTCCGTCTGGCTCTATTTGAACAATTCAAAT

Reverse complement sequence

ATTTGAATTGTTCAAATAGAGCCAGACGGAGAAATGACCAAAATAAAAATTTTGCATAACAATGTGTTCTACAATTTTTATTTTGGTGACTTTTCTATTT[A/G]
AAATCATTTATTAACCTCAATTTTTGTTCGAAGTTATCAAATTTTGAAAATTCAAAATTTGAATTGTCCAAATGAACTTATTTGTGAAAAGTAGCAATAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.80% 23.90% 0.57% 40.77% NA
All Indica  2759 3.90% 33.30% 0.80% 61.94% NA
All Japonica  1512 98.30% 0.90% 0.00% 0.86% NA
Aus  269 0.40% 33.10% 0.74% 65.80% NA
Indica I  595 0.50% 22.40% 1.18% 75.97% NA
Indica II  465 10.50% 32.70% 1.08% 55.70% NA
Indica III  913 3.10% 44.80% 0.33% 51.81% NA
Indica Intermediate  786 3.60% 28.80% 0.89% 66.79% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 98.20% 1.20% 0.00% 0.60% NA
Japonica Intermediate  241 95.90% 2.90% 0.00% 1.24% NA
VI/Aromatic  96 11.50% 84.40% 1.04% 3.12% NA
Intermediate  90 42.20% 27.80% 2.22% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216350616 T -> DEL N N silent_mutation Average:26.723; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350616 T -> C LOC_Os02g27592.1 upstream_gene_variant ; 4927.0bp to feature; MODIFIER silent_mutation Average:26.723; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350616 T -> C LOC_Os02g27594.1 upstream_gene_variant ; 350.0bp to feature; MODIFIER silent_mutation Average:26.723; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350616 T -> C LOC_Os02g27592.2 upstream_gene_variant ; 4927.0bp to feature; MODIFIER silent_mutation Average:26.723; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350616 T -> C LOC_Os02g27594.2 upstream_gene_variant ; 350.0bp to feature; MODIFIER silent_mutation Average:26.723; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350616 T -> C LOC_Os02g27594.3 upstream_gene_variant ; 350.0bp to feature; MODIFIER silent_mutation Average:26.723; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350616 T -> C LOC_Os02g27594-LOC_Os02g27600 intergenic_region ; MODIFIER silent_mutation Average:26.723; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216350616 NA 4.58E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 6.91E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 7.93E-08 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 1.37E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 1.97E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 1.75E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 1.75E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 2.01E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 5.33E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 9.54E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 7.43E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 5.21E-26 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 1.48E-17 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 1.11E-06 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 7.87E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 8.24E-12 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 2.26E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 9.60E-09 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 1.43E-09 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 1.53E-06 1.91E-11 mr1610_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 1.31E-08 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 7.76E-29 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 1.53E-20 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 2.28E-12 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 4.80E-10 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 NA 1.13E-14 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350616 8.12E-06 4.10E-14 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251