\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216350599:

Variant ID: vg0216350599 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16350599
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.05, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CGAGATCTACAACTATTGTATTGCTACTTTTCACAAATAAGTTCATTTGGACAATTCAAATTTTGAATTTTCAAAATTTGATAACTTCGAACAAAAATTG[A/G]
GGTTAATAAATGATTTTAAATAGAAAAGTCACCAAAATAAAAATTGTAGAACACATTGTTATGCAAAATTTTTATTTTGGTCATTTCTCCGTCTGGCTCT

Reverse complement sequence

AGAGCCAGACGGAGAAATGACCAAAATAAAAATTTTGCATAACAATGTGTTCTACAATTTTTATTTTGGTGACTTTTCTATTTAAAATCATTTATTAACC[T/C]
CAATTTTTGTTCGAAGTTATCAAATTTTGAAAATTCAAAATTTGAATTGTCCAAATGAACTTATTTGTGAAAAGTAGCAATACAATAGTTGTAGATCTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.70% 23.90% 0.47% 40.88% NA
All Indica  2759 3.80% 33.40% 0.62% 62.12% NA
All Japonica  1512 98.30% 0.90% 0.00% 0.86% NA
Aus  269 0.40% 33.10% 0.74% 65.80% NA
Indica I  595 0.70% 22.20% 0.67% 76.47% NA
Indica II  465 10.50% 32.70% 0.43% 56.34% NA
Indica III  913 2.80% 45.00% 0.33% 51.81% NA
Indica Intermediate  786 3.40% 28.90% 1.02% 66.67% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 98.20% 1.20% 0.00% 0.60% NA
Japonica Intermediate  241 95.90% 2.90% 0.00% 1.24% NA
VI/Aromatic  96 11.50% 84.40% 1.04% 3.12% NA
Intermediate  90 42.20% 27.80% 2.22% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216350599 A -> G LOC_Os02g27592.1 upstream_gene_variant ; 4910.0bp to feature; MODIFIER silent_mutation Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350599 A -> G LOC_Os02g27594.1 upstream_gene_variant ; 333.0bp to feature; MODIFIER silent_mutation Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350599 A -> G LOC_Os02g27592.2 upstream_gene_variant ; 4910.0bp to feature; MODIFIER silent_mutation Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350599 A -> G LOC_Os02g27594.2 upstream_gene_variant ; 333.0bp to feature; MODIFIER silent_mutation Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350599 A -> G LOC_Os02g27594.3 upstream_gene_variant ; 333.0bp to feature; MODIFIER silent_mutation Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350599 A -> G LOC_Os02g27594-LOC_Os02g27600 intergenic_region ; MODIFIER silent_mutation Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0216350599 A -> DEL N N silent_mutation Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216350599 NA 8.69E-10 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 2.78E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 6.37E-30 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 1.56E-19 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 1.25E-08 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 2.95E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 1.92E-11 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 8.66E-14 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 7.84E-06 5.68E-11 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 5.50E-06 1.29E-10 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 3.66E-06 NA mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 4.45E-07 1.79E-12 mr1610_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 1.15E-11 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 5.66E-06 3.12E-10 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 8.02E-34 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 2.06E-23 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 2.26E-15 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 3.84E-11 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 NA 6.99E-16 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 6.77E-06 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599 6.65E-06 5.53E-15 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251