Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216350599:

Variant ID: vg0216350599 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16350599
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.05, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

CGAGATCTACAACTATTGTATTGCTACTTTTCACAAATAAGTTCATTTGGACAATTCAAATTTTGAATTTTCAAAATTTGATAACTTCGAACAAAAATTG[A/G]
GGTTAATAAATGATTTTAAATAGAAAAGTCACCAAAATAAAAATTGTAGAACACATTGTTATGCAAAATTTTTATTTTGGTCATTTCTCCGTCTGGCTCT

Reverse complement sequence

AGAGCCAGACGGAGAAATGACCAAAATAAAAATTTTGCATAACAATGTGTTCTACAATTTTTATTTTGGTGACTTTTCTATTTAAAATCATTTATTAACC[T/C]
CAATTTTTGTTCGAAGTTATCAAATTTTGAAAATTCAAAATTTGAATTGTCCAAATGAACTTATTTGTGAAAAGTAGCAATACAATAGTTGTAGATCTCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.70%	23.90%	0.47%	40.88%	NA
All Indica	2759	3.80%	33.40%	0.62%	62.12%	NA
All Japonica	1512	98.30%	0.90%	0.00%	0.86%	NA
Aus	269	0.40%	33.10%	0.74%	65.80%	NA
Indica I	595	0.70%	22.20%	0.67%	76.47%	NA
Indica II	465	10.50%	32.70%	0.43%	56.34%	NA
Indica III	913	2.80%	45.00%	0.33%	51.81%	NA
Indica Intermediate	786	3.40%	28.90%	1.02%	66.67%	NA
Temperate Japonica	767	99.10%	0.00%	0.00%	0.91%	NA
Tropical Japonica	504	98.20%	1.20%	0.00%	0.60%	NA
Japonica Intermediate	241	95.90%	2.90%	0.00%	1.24%	NA
VI/Aromatic	96	11.50%	84.40%	1.04%	3.12%	NA
Intermediate	90	42.20%	27.80%	2.22%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216350599	A -> G	LOC_Os02g27592.1	upstream_gene_variant ; 4910.0bp to feature; MODIFIER	silent_mutation	Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0216350599	A -> G	LOC_Os02g27594.1	upstream_gene_variant ; 333.0bp to feature; MODIFIER	silent_mutation	Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0216350599	A -> G	LOC_Os02g27592.2	upstream_gene_variant ; 4910.0bp to feature; MODIFIER	silent_mutation	Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0216350599	A -> G	LOC_Os02g27594.2	upstream_gene_variant ; 333.0bp to feature; MODIFIER	silent_mutation	Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0216350599	A -> G	LOC_Os02g27594.3	upstream_gene_variant ; 333.0bp to feature; MODIFIER	silent_mutation	Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0216350599	A -> G	LOC_Os02g27594-LOC_Os02g27600	intergenic_region ; MODIFIER	silent_mutation	Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0216350599	A -> DEL	N	N	silent_mutation	Average:26.78; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216350599	NA	8.69E-10	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	2.78E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	6.37E-30	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	1.56E-19	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	1.25E-08	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	2.95E-06	mr1927	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	1.92E-11	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	8.66E-14	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	7.84E-06	5.68E-11	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	5.50E-06	1.29E-10	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	3.66E-06	NA	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	4.45E-07	1.79E-12	mr1610_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	1.15E-11	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	5.66E-06	3.12E-10	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	8.02E-34	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	2.06E-23	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	2.26E-15	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	3.84E-11	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	NA	6.99E-16	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	6.77E-06	NA	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216350599	6.65E-06	5.53E-15	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251