Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216344351:

Variant ID: vg0216344351 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16344351
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGCAACCTAGATTAATTTAACAGAAAAACATCCCACAACTGATGTAACAGAAAGAATAGGCAAGCAGATAATCCATCATTGATTAATGTCTGAAATCAC[C/G]
ATGTTCAACCTGCAAAAAAAAAATTTGTCAACAAGAATCGGAGATTTCTGAAATTAATTACCACACTGGCCATCAAAGCCAACTAGAGATTGCTAAATAA

Reverse complement sequence

TTATTTAGCAATCTCTAGTTGGCTTTGATGGCCAGTGTGGTAATTAATTTCAGAAATCTCCGATTCTTGTTGACAAATTTTTTTTTTGCAGGTTGAACAT[G/C]
GTGATTTCAGACATTAATCAATGATGGATTATCTGCTTGCCTATTCTTTCTGTTACATCAGTTGTGGGATGTTTTTCTGTTAAATTAATCTAGGTTGCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.10%	19.20%	2.07%	24.63%	NA
All Indica	2759	29.60%	32.20%	3.30%	34.90%	NA
All Japonica	1512	99.10%	0.30%	0.13%	0.53%	NA
Aus	269	33.10%	1.10%	1.86%	63.94%	NA
Indica I	595	20.50%	39.80%	2.02%	37.65%	NA
Indica II	465	30.50%	44.70%	2.80%	21.94%	NA
Indica III	913	38.80%	23.90%	4.05%	33.30%	NA
Indica Intermediate	786	25.30%	28.60%	3.69%	42.37%	NA
Temperate Japonica	767	99.10%	0.30%	0.13%	0.52%	NA
Tropical Japonica	504	99.20%	0.00%	0.00%	0.79%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	67.80%	12.20%	0.00%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216344351	C -> G	LOC_Os02g27592.1	3_prime_UTR_variant ; 482.0bp to feature; MODIFIER	silent_mutation	Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326	N	N	N	N
vg0216344351	C -> G	LOC_Os02g27592.2	3_prime_UTR_variant ; 482.0bp to feature; MODIFIER	silent_mutation	Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326	N	N	N	N
vg0216344351	C -> G	LOC_Os02g27594.1	downstream_gene_variant ; 3336.0bp to feature; MODIFIER	silent_mutation	Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326	N	N	N	N
vg0216344351	C -> G	LOC_Os02g27594.2	downstream_gene_variant ; 3350.0bp to feature; MODIFIER	silent_mutation	Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326	N	N	N	N
vg0216344351	C -> G	LOC_Os02g27594.3	downstream_gene_variant ; 3350.0bp to feature; MODIFIER	silent_mutation	Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326	N	N	N	N
vg0216344351	C -> DEL	N	N	silent_mutation	Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216344351	1.23E-06	1.34E-09	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	7.56E-06	NA	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	2.41E-06	NA	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	3.20E-07	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	6.29E-06	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	4.29E-07	NA	mr1142	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	1.59E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	6.45E-07	3.25E-10	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	7.43E-08	9.42E-12	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	7.18E-07	mr1350	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	8.59E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	8.22E-07	mr1610	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	3.28E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	4.17E-07	NA	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	5.32E-08	2.74E-22	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	3.07E-06	mr1863	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	2.89E-07	2.04E-15	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	1.27E-08	2.99E-12	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	2.03E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	1.38E-08	mr1927	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	2.33E-09	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	7.13E-09	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	4.74E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	NA	1.08E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	5.42E-08	4.41E-11	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	3.86E-09	1.28E-15	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	2.08E-06	NA	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	3.28E-07	8.64E-09	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	2.36E-07	NA	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	3.82E-08	3.52E-15	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	4.11E-07	NA	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	2.37E-08	2.81E-11	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	1.07E-10	NA	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	1.37E-11	1.94E-25	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	2.91E-07	NA	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	3.34E-08	1.18E-12	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	5.66E-08	1.08E-14	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	3.61E-08	7.83E-21	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	5.05E-08	NA	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351	4.99E-08	1.61E-18	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251