\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216344351:

Variant ID: vg0216344351 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16344351
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCAACCTAGATTAATTTAACAGAAAAACATCCCACAACTGATGTAACAGAAAGAATAGGCAAGCAGATAATCCATCATTGATTAATGTCTGAAATCAC[C/G]
ATGTTCAACCTGCAAAAAAAAAATTTGTCAACAAGAATCGGAGATTTCTGAAATTAATTACCACACTGGCCATCAAAGCCAACTAGAGATTGCTAAATAA

Reverse complement sequence

TTATTTAGCAATCTCTAGTTGGCTTTGATGGCCAGTGTGGTAATTAATTTCAGAAATCTCCGATTCTTGTTGACAAATTTTTTTTTTGCAGGTTGAACAT[G/C]
GTGATTTCAGACATTAATCAATGATGGATTATCTGCTTGCCTATTCTTTCTGTTACATCAGTTGTGGGATGTTTTTCTGTTAAATTAATCTAGGTTGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 19.20% 2.07% 24.63% NA
All Indica  2759 29.60% 32.20% 3.30% 34.90% NA
All Japonica  1512 99.10% 0.30% 0.13% 0.53% NA
Aus  269 33.10% 1.10% 1.86% 63.94% NA
Indica I  595 20.50% 39.80% 2.02% 37.65% NA
Indica II  465 30.50% 44.70% 2.80% 21.94% NA
Indica III  913 38.80% 23.90% 4.05% 33.30% NA
Indica Intermediate  786 25.30% 28.60% 3.69% 42.37% NA
Temperate Japonica  767 99.10% 0.30% 0.13% 0.52% NA
Tropical Japonica  504 99.20% 0.00% 0.00% 0.79% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 67.80% 12.20% 0.00% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216344351 C -> G LOC_Os02g27592.1 3_prime_UTR_variant ; 482.0bp to feature; MODIFIER silent_mutation Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N
vg0216344351 C -> G LOC_Os02g27592.2 3_prime_UTR_variant ; 482.0bp to feature; MODIFIER silent_mutation Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N
vg0216344351 C -> G LOC_Os02g27594.1 downstream_gene_variant ; 3336.0bp to feature; MODIFIER silent_mutation Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N
vg0216344351 C -> G LOC_Os02g27594.2 downstream_gene_variant ; 3350.0bp to feature; MODIFIER silent_mutation Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N
vg0216344351 C -> G LOC_Os02g27594.3 downstream_gene_variant ; 3350.0bp to feature; MODIFIER silent_mutation Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N
vg0216344351 C -> DEL N N silent_mutation Average:43.495; most accessible tissue: Minghui63 flag leaf, score: 87.326 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216344351 1.23E-06 1.34E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 7.56E-06 NA mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 2.41E-06 NA mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 3.20E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 6.29E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 4.29E-07 NA mr1142 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 1.59E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 6.45E-07 3.25E-10 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 7.43E-08 9.42E-12 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 7.18E-07 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 8.59E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 8.22E-07 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 3.28E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 4.17E-07 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 5.32E-08 2.74E-22 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 3.07E-06 mr1863 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 2.89E-07 2.04E-15 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 1.27E-08 2.99E-12 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 2.03E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 1.38E-08 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 2.33E-09 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 7.13E-09 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 4.74E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 NA 1.08E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 5.42E-08 4.41E-11 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 3.86E-09 1.28E-15 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 2.08E-06 NA mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 3.28E-07 8.64E-09 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 2.36E-07 NA mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 3.82E-08 3.52E-15 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 4.11E-07 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 2.37E-08 2.81E-11 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 1.07E-10 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 1.37E-11 1.94E-25 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 2.91E-07 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 3.34E-08 1.18E-12 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 5.66E-08 1.08E-14 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 3.61E-08 7.83E-21 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 5.05E-08 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344351 4.99E-08 1.61E-18 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251