\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216344341:

Variant ID: vg0216344341 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16344341
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGATCAAGAGAGCAACCTAGATTAATTTAACAGAAAAACATCCCACAACTGATGTAACAGAAAGAATAGGCAAGCAGATAATCCATCATTGATTAATGT[C/A]
TGAAATCACCATGTTCAACCTGCAAAAAAAAAATTTGTCAACAAGAATCGGAGATTTCTGAAATTAATTACCACACTGGCCATCAAAGCCAACTAGAGAT

Reverse complement sequence

ATCTCTAGTTGGCTTTGATGGCCAGTGTGGTAATTAATTTCAGAAATCTCCGATTCTTGTTGACAAATTTTTTTTTTGCAGGTTGAACATGGTGATTTCA[G/T]
ACATTAATCAATGATGGATTATCTGCTTGCCTATTCTTTCTGTTACATCAGTTGTGGGATGTTTTTCTGTTAAATTAATCTAGGTTGCTCTCTTGATCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 19.10% 1.99% 24.97% NA
All Indica  2759 29.20% 32.10% 3.12% 35.52% NA
All Japonica  1512 99.10% 0.30% 0.13% 0.53% NA
Aus  269 33.10% 1.10% 2.23% 63.57% NA
Indica I  595 20.50% 39.70% 2.18% 37.65% NA
Indica II  465 30.50% 44.70% 2.80% 21.94% NA
Indica III  913 37.90% 23.90% 3.18% 35.05% NA
Indica Intermediate  786 24.90% 28.60% 3.94% 42.49% NA
Temperate Japonica  767 99.10% 0.30% 0.13% 0.52% NA
Tropical Japonica  504 99.20% 0.00% 0.00% 0.79% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 67.80% 12.20% 0.00% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216344341 C -> A LOC_Os02g27592.1 3_prime_UTR_variant ; 492.0bp to feature; MODIFIER silent_mutation Average:43.126; most accessible tissue: Minghui63 flag leaf, score: 86.618 N N N N
vg0216344341 C -> A LOC_Os02g27592.2 3_prime_UTR_variant ; 492.0bp to feature; MODIFIER silent_mutation Average:43.126; most accessible tissue: Minghui63 flag leaf, score: 86.618 N N N N
vg0216344341 C -> A LOC_Os02g27594.1 downstream_gene_variant ; 3346.0bp to feature; MODIFIER silent_mutation Average:43.126; most accessible tissue: Minghui63 flag leaf, score: 86.618 N N N N
vg0216344341 C -> A LOC_Os02g27594.2 downstream_gene_variant ; 3360.0bp to feature; MODIFIER silent_mutation Average:43.126; most accessible tissue: Minghui63 flag leaf, score: 86.618 N N N N
vg0216344341 C -> A LOC_Os02g27594.3 downstream_gene_variant ; 3360.0bp to feature; MODIFIER silent_mutation Average:43.126; most accessible tissue: Minghui63 flag leaf, score: 86.618 N N N N
vg0216344341 C -> DEL N N silent_mutation Average:43.126; most accessible tissue: Minghui63 flag leaf, score: 86.618 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216344341 4.18E-07 4.56E-10 mr1023 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 5.84E-06 NA mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 4.48E-06 NA mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 9.25E-08 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 2.16E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 7.38E-07 NA mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 1.53E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 1.20E-06 3.62E-10 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 1.14E-07 7.31E-12 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 1.01E-07 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 7.70E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 8.72E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 8.32E-07 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 5.61E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 3.66E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 2.07E-07 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 2.63E-08 2.60E-23 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 1.75E-06 mr1863 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 5.52E-07 5.03E-15 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 2.14E-08 9.48E-12 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 8.30E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 1.22E-08 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 8.37E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 2.03E-10 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 7.09E-10 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 7.38E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 2.10E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 1.40E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 6.03E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 1.20E-08 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 1.19E-08 1.44E-11 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 4.72E-10 9.41E-17 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 1.97E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 2.59E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 NA 1.54E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 1.05E-06 NA mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 1.28E-07 3.72E-09 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 5.22E-08 NA mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 8.36E-09 5.74E-16 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 7.99E-08 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 2.72E-09 3.12E-12 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 2.44E-10 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 1.49E-11 3.63E-26 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 7.99E-08 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 5.21E-09 2.21E-13 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 1.23E-08 4.84E-15 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 5.24E-09 7.80E-22 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 8.48E-09 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216344341 4.65E-09 1.14E-19 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251