RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0216273226:

Variant ID: vg0216273226 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16273226
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTTCTATTCATACTTCTCTCCAAAATCCTTACCCACATATCTCGTTGAGTAGTCAAACTCAAACTCCCAAGTTACACTCTCTTTCTCTAAATTATCCAT[C/T]
CCCTTTTGACTCGTCTCCGAATATTGTTCCCTTCCTTGACTCCTCCCCCTCATCCATATTCCTCTTCCAATTCAAGTCTCCAAATCAAAAACCCCAATTC

Reverse complement sequence

GAATTGGGGTTTTTGATTTGGAGACTTGAATTGGAAGAGGAATATGGATGAGGGGGAGGAGTCAAGGAAGGGAACAATATTCGGAGACGAGTCAAAAGGG[G/A]
ATGGATAATTTAGAGAAAGAGAGTGTAACTTGGGAGTTTGAGTTTGACTACTCAACGAGATATGTGGGTAAGGATTTTGGAGAGAAGTATGAATAGAAGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.60%	1.90%	26.34%	37.07%	NA
All Indica	2759	7.20%	0.00%	36.82%	55.93%	NA
All Japonica	1512	90.90%	6.10%	2.31%	0.66%	NA
Aus	269	3.00%	0.00%	59.48%	37.55%	NA
Indica I	595	4.40%	0.00%	24.03%	71.60%	NA
Indica II	465	12.90%	0.00%	20.22%	66.88%	NA
Indica III	913	7.10%	0.00%	55.97%	36.91%	NA
Indica Intermediate	786	6.20%	0.00%	34.10%	59.67%	NA
Temperate Japonica	767	88.40%	9.00%	1.83%	0.78%	NA
Tropical Japonica	504	97.20%	0.20%	2.38%	0.20%	NA
Japonica Intermediate	241	85.90%	9.10%	3.73%	1.24%	NA
VI/Aromatic	96	13.50%	0.00%	17.71%	68.75%	NA
Intermediate	90	45.60%	0.00%	18.89%	35.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216273226	C -> T	LOC_Os02g27500.1	upstream_gene_variant ; 677.0bp to feature; MODIFIER	silent_mutation	Average:39.786; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg0216273226	C -> T	LOC_Os02g27490.1	downstream_gene_variant ; 4391.0bp to feature; MODIFIER	silent_mutation	Average:39.786; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg0216273226	C -> T	LOC_Os02g27500-LOC_Os02g27510	intergenic_region ; MODIFIER	silent_mutation	Average:39.786; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg0216273226	C -> DEL	N	N	silent_mutation	Average:39.786; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216273226	2.15E-08	6.12E-09	mr1305_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216273226	8.08E-06	8.08E-06	mr1897_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216273226	5.98E-06	5.98E-06	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0216273226:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact