| Variant ID: vg0216273226 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16273226 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCTTCTATTCATACTTCTCTCCAAAATCCTTACCCACATATCTCGTTGAGTAGTCAAACTCAAACTCCCAAGTTACACTCTCTTTCTCTAAATTATCCAT[C/T]
CCCTTTTGACTCGTCTCCGAATATTGTTCCCTTCCTTGACTCCTCCCCCTCATCCATATTCCTCTTCCAATTCAAGTCTCCAAATCAAAAACCCCAATTC
GAATTGGGGTTTTTGATTTGGAGACTTGAATTGGAAGAGGAATATGGATGAGGGGGAGGAGTCAAGGAAGGGAACAATATTCGGAGACGAGTCAAAAGGG[G/A]
ATGGATAATTTAGAGAAAGAGAGTGTAACTTGGGAGTTTGAGTTTGACTACTCAACGAGATATGTGGGTAAGGATTTTGGAGAGAAGTATGAATAGAAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.60% | 1.90% | 26.34% | 37.07% | NA |
| All Indica | 2759 | 7.20% | 0.00% | 36.82% | 55.93% | NA |
| All Japonica | 1512 | 90.90% | 6.10% | 2.31% | 0.66% | NA |
| Aus | 269 | 3.00% | 0.00% | 59.48% | 37.55% | NA |
| Indica I | 595 | 4.40% | 0.00% | 24.03% | 71.60% | NA |
| Indica II | 465 | 12.90% | 0.00% | 20.22% | 66.88% | NA |
| Indica III | 913 | 7.10% | 0.00% | 55.97% | 36.91% | NA |
| Indica Intermediate | 786 | 6.20% | 0.00% | 34.10% | 59.67% | NA |
| Temperate Japonica | 767 | 88.40% | 9.00% | 1.83% | 0.78% | NA |
| Tropical Japonica | 504 | 97.20% | 0.20% | 2.38% | 0.20% | NA |
| Japonica Intermediate | 241 | 85.90% | 9.10% | 3.73% | 1.24% | NA |
| VI/Aromatic | 96 | 13.50% | 0.00% | 17.71% | 68.75% | NA |
| Intermediate | 90 | 45.60% | 0.00% | 18.89% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216273226 | C -> T | LOC_Os02g27500.1 | upstream_gene_variant ; 677.0bp to feature; MODIFIER | silent_mutation | Average:39.786; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0216273226 | C -> T | LOC_Os02g27490.1 | downstream_gene_variant ; 4391.0bp to feature; MODIFIER | silent_mutation | Average:39.786; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0216273226 | C -> T | LOC_Os02g27500-LOC_Os02g27510 | intergenic_region ; MODIFIER | silent_mutation | Average:39.786; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0216273226 | C -> DEL | N | N | silent_mutation | Average:39.786; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216273226 | 2.15E-08 | 6.12E-09 | mr1305_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216273226 | 8.08E-06 | 8.08E-06 | mr1897_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216273226 | 5.98E-06 | 5.98E-06 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |