RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0216223264:

Variant ID: vg0216223264 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 16223264
Reference Allele: T	Alternative Allele: A,TAA,TAATAA
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACTTCTAATTGCAGCACATGATTTTCTAACTAAATATATATCCAAGCGAATTTACCACAATAAATTTTATTTTAACTAAACCATATAATAATAATAATA[T/A,TAA,TAATAA]
GATTAAAATAGTGTTCAACTGTTGCAACGCACGGGCATTTTTCTAGCACATATATATATTCACTAGTTGCCAGCTAGGAAAAAAGTTGCAGTCTTCAAAA

Reverse complement sequence

TTTTGAAGACTGCAACTTTTTTCCTAGCTGGCAACTAGTGAATATATATATGTGCTAGAAAAATGCCCGTGCGTTGCAACAGTTGAACACTATTTTAATC[A/T,TTA,TTATTA]
TATTATTATTATTATATGGTTTAGTTAAAATAAAATTTATTGTGGTAAATTCGCTTGGATATATATTTAGTTAGAAAATCATGTGCTGCAATTAGAAGTC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.10%	34.20%	0.68%	0.00%	TAA: 11.00%; TAATAA: 0.02%
All Indica	2759	84.00%	3.30%	0.94%	0.00%	TAA: 11.74%
All Japonica	1512	0.90%	97.90%	0.07%	0.00%	TAA: 1.12%
Aus	269	68.40%	0.40%	0.37%	0.00%	TAA: 30.48%; TAATAA: 0.37%
Indica I	595	95.80%	0.20%	2.02%	0.00%	TAA: 2.02%
Indica II	465	63.70%	9.90%	0.65%	0.00%	TAA: 25.81%
Indica III	913	86.90%	2.60%	0.00%	0.00%	TAA: 10.51%
Indica Intermediate	786	83.80%	2.50%	1.40%	0.00%	TAA: 12.21%
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	97.40%	0.00%	0.00%	TAA: 1.98%
Japonica Intermediate	241	1.20%	95.40%	0.41%	0.00%	TAA: 2.90%
VI/Aromatic	96	3.10%	9.40%	1.04%	0.00%	TAA: 86.46%
Intermediate	90	41.10%	40.00%	3.33%	0.00%	TAA: 15.56%

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216223264	T -> A	LOC_Os02g27470-LOC_Os02g27480	intergenic_region ; MODIFIER	silent_mutation	Average:84.431; most accessible tissue: Minghui63 panicle, score: 98.68	N	N	N	N
vg0216223264	T -> TAATAA	LOC_Os02g27470-LOC_Os02g27480	intergenic_region ; MODIFIER	silent_mutation	Average:84.431; most accessible tissue: Minghui63 panicle, score: 98.68	N	N	N	N
vg0216223264	T -> TAA	LOC_Os02g27470-LOC_Os02g27480	intergenic_region ; MODIFIER	silent_mutation	Average:84.431; most accessible tissue: Minghui63 panicle, score: 98.68	N	N	N	N

Showing 1 to 3 of 3 entries

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Show entries

Search:

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0216223264	T	A	0.0	0.0	0.0	-0.02	0.0	0.01
vg0216223264	T	TAA	0.06	0.29	0.19	0.05	0.11	0.11
vg0216223264	T	TAATA*	0.21	0.37	0.14	-0.03	0.13	0.15

Showing 1 to 3 of 3 entries

Previous1Next

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216223264	3.44E-06	NA	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216223264	3.39E-08	1.09E-11	mr1089	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216223264	1.70E-06	2.35E-11	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216223264	NA	2.08E-11	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216223264	7.59E-06	NA	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216223264	8.08E-07	8.57E-13	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216223264	8.04E-07	NA	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216223264	5.03E-08	1.28E-11	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216223264	NA	1.77E-31	mr1243	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216223264	NA	8.94E-07	mr1243	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 55 entries

Previous1 2 3 4 5 6Next

Search for Variation information by Variation ID:

Detailed information for vg0216223264:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Effects Predicted by Deep Convolutional Neural Networks

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact