\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216163461:

Variant ID: vg0216163461 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16163461
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, A: 0.18, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCTATGGACACAGGTCGTCTACAGTACTGCAGGGGATCTCAATTGGTGTTCTATACTCTGGCGCCAAAACTGAGCGAGGGCTGCCTTTTTCCCTCCAT[T/A]
ATCCAGAACTGCACCTCTGTTTTTCCCGCGCCGACCGCGTGCTGTGCTATTGGGAGTATACAGTCAAATAAGGGGAAGATGGATGTGTGCCGTTGGATGT

Reverse complement sequence

ACATCCAACGGCACACATCCATCTTCCCCTTATTTGACTGTATACTCCCAATAGCACAGCACGCGGTCGGCGCGGGAAAAACAGAGGTGCAGTTCTGGAT[A/T]
ATGGAGGGAAAAAGGCAGCCCTCGCTCAGTTTTGGCGCCAGAGTATAGAACACCAATTGAGATCCCCTGCAGTACTGTAGACGACCTGTGTCCATAGAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 11.30% 0.08% 0.00% NA
All Indica  2759 87.50% 12.40% 0.07% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 69.10% 30.50% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 74.00% 25.80% 0.22% 0.00% NA
Indica III  913 86.50% 13.40% 0.11% 0.00% NA
Indica Intermediate  786 87.30% 12.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 14.60% 84.40% 1.04% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216163461 T -> A LOC_Os02g27430.1 upstream_gene_variant ; 2571.0bp to feature; MODIFIER silent_mutation Average:97.615; most accessible tissue: Zhenshan97 panicle, score: 98.901 N N N N
vg0216163461 T -> A LOC_Os02g27420.1 downstream_gene_variant ; 3331.0bp to feature; MODIFIER silent_mutation Average:97.615; most accessible tissue: Zhenshan97 panicle, score: 98.901 N N N N
vg0216163461 T -> A LOC_Os02g27430-LOC_Os02g27440 intergenic_region ; MODIFIER silent_mutation Average:97.615; most accessible tissue: Zhenshan97 panicle, score: 98.901 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0216163461 T A -0.05 -0.04 -0.02 -0.05 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216163461 NA 7.97E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 5.30E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 6.85E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 6.80E-08 7.73E-13 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 9.36E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 2.87E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 6.14E-06 1.59E-08 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 2.08E-11 7.50E-25 mr1855 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 7.43E-12 1.61E-23 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 4.72E-07 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 1.04E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 8.07E-10 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 3.43E-07 2.42E-14 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 9.16E-09 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 1.98E-08 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 1.11E-09 6.47E-21 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 2.79E-09 8.08E-18 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 6.96E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 2.79E-10 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 4.84E-13 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 8.51E-07 1.13E-13 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216163461 NA 1.55E-09 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251