RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0216121609:

Variant ID: vg0216121609 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16121609
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

AATGTTGACAAGGCTCCACGCAGACTCTACGCCTTCTCGATCGCTCAAGAACGGTTGCTGGATCTCGACAAGGAATACAGAATGAAAAGATGGTGTACCC[G/A]
CCGAGATAAAATTTCTTGACTTCAATCCAAATTCTCGATTACAGCAAGACGGGAGACTTAGTCGTCTGCTCTGTACTTCCTTGGTTGACATCGGAGATTG

Reverse complement sequence

CAATCTCCGATGTCAACCAAGGAAGTACAGAGCAGACGACTAAGTCTCCCGTCTTGCTGTAATCGAGAATTTGGATTGAAGTCAAGAAATTTTATCTCGG[C/T]
GGGTACACCATCTTTTCATTCTGTATTCCTTGTCGAGATCCAGCAACCGTTCTTGAGCGATCGAGAAGGCGTAGAGTCTGCGTGGAGCCTTGTCAACATT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.30%	7.70%	0.02%	0.00%	NA
All Indica	2759	90.10%	9.90%	0.00%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	69.50%	30.10%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	75.30%	24.70%	0.00%	0.00%	NA
Indica III	913	91.70%	8.30%	0.00%	0.00%	NA
Indica Intermediate	786	89.60%	10.40%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216121609	G -> A	LOC_Os02g27360.1	upstream_gene_variant ; 1169.0bp to feature; MODIFIER	silent_mutation	Average:55.259; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg0216121609	G -> A	LOC_Os02g27360.2	upstream_gene_variant ; 1170.0bp to feature; MODIFIER	silent_mutation	Average:55.259; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg0216121609	G -> A	LOC_Os02g27360-LOC_Os02g27370	intergenic_region ; MODIFIER	silent_mutation	Average:55.259; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216121609	NA	3.26E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	1.80E-06	4.16E-14	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	1.17E-06	2.02E-11	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	2.79E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	1.90E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	9.88E-12	2.81E-38	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	9.58E-11	1.09E-22	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	1.49E-06	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	NA	7.64E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609	3.90E-07	5.18E-17	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 23 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0216121609:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact