\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216121609:

Variant ID: vg0216121609 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16121609
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


AATGTTGACAAGGCTCCACGCAGACTCTACGCCTTCTCGATCGCTCAAGAACGGTTGCTGGATCTCGACAAGGAATACAGAATGAAAAGATGGTGTACCC[G/A]
CCGAGATAAAATTTCTTGACTTCAATCCAAATTCTCGATTACAGCAAGACGGGAGACTTAGTCGTCTGCTCTGTACTTCCTTGGTTGACATCGGAGATTG

Reverse complement sequence

CAATCTCCGATGTCAACCAAGGAAGTACAGAGCAGACGACTAAGTCTCCCGTCTTGCTGTAATCGAGAATTTGGATTGAAGTCAAGAAATTTTATCTCGG[C/T]
GGGTACACCATCTTTTCATTCTGTATTCCTTGTCGAGATCCAGCAACCGTTCTTGAGCGATCGAGAAGGCGTAGAGTCTGCGTGGAGCCTTGTCAACATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.30% 7.70% 0.02% 0.00% NA
All Indica  2759 90.10% 9.90% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 69.50% 30.10% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 75.30% 24.70% 0.00% 0.00% NA
Indica III  913 91.70% 8.30% 0.00% 0.00% NA
Indica Intermediate  786 89.60% 10.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216121609 G -> A LOC_Os02g27360.1 upstream_gene_variant ; 1169.0bp to feature; MODIFIER silent_mutation Average:55.259; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg0216121609 G -> A LOC_Os02g27360.2 upstream_gene_variant ; 1170.0bp to feature; MODIFIER silent_mutation Average:55.259; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg0216121609 G -> A LOC_Os02g27360-LOC_Os02g27370 intergenic_region ; MODIFIER silent_mutation Average:55.259; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216121609 NA 3.26E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 1.80E-06 4.16E-14 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 1.17E-06 2.02E-11 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 2.79E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 1.90E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 9.88E-12 2.81E-38 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 9.58E-11 1.09E-22 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 1.49E-06 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 7.64E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 3.90E-07 5.18E-17 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 3.30E-07 2.65E-13 mr1317_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 8.88E-09 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 7.89E-12 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 6.60E-06 2.04E-09 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 3.17E-12 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 3.10E-08 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 1.82E-07 1.82E-30 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 8.52E-07 1.65E-15 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 1.18E-14 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 9.42E-10 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 4.99E-06 2.63E-16 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 1.23E-12 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216121609 NA 2.77E-09 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251