\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216078062:

Variant ID: vg0216078062 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16078062
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GGAATAATGCCATATGTACATTTTGTAACACCATGATAACTCTTTGTGGGGACCACTATTCTCTAGAGCAACCAACCAAGCACTCAAGATTGCTTCTCGA[T/A]
TTTCCAAGATCTCTGGGATAATCTAGCTTCTATTGGCTATTACATACGAACTTATCTTACACTCACTATTAGAGTAGGTACAATAAAGATAGTGAGCGTA

Reverse complement sequence

TACGCTCACTATCTTTATTGTACCTACTCTAATAGTGAGTGTAAGATAAGTTCGTATGTAATAGCCAATAGAAGCTAGATTATCCCAGAGATCTTGGAAA[A/T]
TCGAGAAGCAATCTTGAGTGCTTGGTTGGTTGCTCTAGAGAATAGTGGTCCCCACAAAGAGTTATCATGGTGTTACAAAATGTACATATGGCATTATTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.90% 6.50% 0.59% 0.00% NA
All Indica  2759 97.60% 2.40% 0.00% 0.00% NA
All Japonica  1512 83.70% 14.60% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 92.00% 8.00% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 1.10% 0.00% 0.00% NA
Temperate Japonica  767 97.30% 2.10% 0.65% 0.00% NA
Tropical Japonica  504 77.80% 20.60% 1.59% 0.00% NA
Japonica Intermediate  241 52.70% 41.90% 5.39% 0.00% NA
VI/Aromatic  96 86.50% 12.50% 1.04% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216078062 T -> A LOC_Os02g27300.1 upstream_gene_variant ; 4514.0bp to feature; MODIFIER silent_mutation Average:41.017; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0216078062 T -> A LOC_Os02g27290.1 downstream_gene_variant ; 3442.0bp to feature; MODIFIER silent_mutation Average:41.017; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0216078062 T -> A LOC_Os02g27290-LOC_Os02g27300 intergenic_region ; MODIFIER silent_mutation Average:41.017; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216078062 NA 8.29E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062 NA 8.36E-11 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062 NA 2.57E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062 NA 3.95E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062 NA 2.38E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062 NA 7.24E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062 2.33E-07 3.27E-14 mr1691_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216078062 NA 7.44E-08 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251