\
| Variant ID: vg0216078062 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16078062 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )
GGAATAATGCCATATGTACATTTTGTAACACCATGATAACTCTTTGTGGGGACCACTATTCTCTAGAGCAACCAACCAAGCACTCAAGATTGCTTCTCGA[T/A]
TTTCCAAGATCTCTGGGATAATCTAGCTTCTATTGGCTATTACATACGAACTTATCTTACACTCACTATTAGAGTAGGTACAATAAAGATAGTGAGCGTA
TACGCTCACTATCTTTATTGTACCTACTCTAATAGTGAGTGTAAGATAAGTTCGTATGTAATAGCCAATAGAAGCTAGATTATCCCAGAGATCTTGGAAA[A/T]
TCGAGAAGCAATCTTGAGTGCTTGGTTGGTTGCTCTAGAGAATAGTGGTCCCCACAAAGAGTTATCATGGTGTTACAAAATGTACATATGGCATTATTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 6.50% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 83.70% | 14.60% | 1.72% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 2.10% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 77.80% | 20.60% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 52.70% | 41.90% | 5.39% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 12.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216078062 | T -> A | LOC_Os02g27300.1 | upstream_gene_variant ; 4514.0bp to feature; MODIFIER | silent_mutation | Average:41.017; most accessible tissue: Zhenshan97 flower, score: 69.089 | N | N | N | N |
| vg0216078062 | T -> A | LOC_Os02g27290.1 | downstream_gene_variant ; 3442.0bp to feature; MODIFIER | silent_mutation | Average:41.017; most accessible tissue: Zhenshan97 flower, score: 69.089 | N | N | N | N |
| vg0216078062 | T -> A | LOC_Os02g27290-LOC_Os02g27300 | intergenic_region ; MODIFIER | silent_mutation | Average:41.017; most accessible tissue: Zhenshan97 flower, score: 69.089 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216078062 | NA | 8.29E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216078062 | NA | 8.36E-11 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216078062 | NA | 2.57E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216078062 | NA | 3.95E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216078062 | NA | 2.38E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216078062 | NA | 7.24E-07 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216078062 | 2.33E-07 | 3.27E-14 | mr1691_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216078062 | NA | 7.44E-08 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |