\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216032860:

Variant ID: vg0216032860 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16032860
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCGGAGAACACCTGAGCTTGTAGAGGGGAGAAAGAGAAAGAGGAAGAGGGTTTCTAGAGCTTGAACTCTCTTACTCTTCAGCTCTTTGTAACTCCTTC[A/G]
TACACAGATCCACCAGAATACAGGAGTAGGGTATTACGCTTCTCAGCGGCCCGAACCTGTCTACATCGCCCGTGTCTTGTGCATTTGCTCTCTCGCGAAA

Reverse complement sequence

TTTCGCGAGAGAGCAAATGCACAAGACACGGGCGATGTAGACAGGTTCGGGCCGCTGAGAAGCGTAATACCCTACTCCTGTATTCTGGTGGATCTGTGTA[T/C]
GAAGGAGTTACAAAGAGCTGAAGAGTAAGAGAGTTCAAGCTCTAGAAACCCTCTTCCTCTTTCTCTTTCTCCCCTCTACAAGCTCAGGTGTTCTCCGAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.70% 26.90% 4.91% 32.59% NA
All Indica  2759 4.80% 44.50% 4.71% 45.96% NA
All Japonica  1512 98.20% 0.70% 0.07% 0.99% NA
Aus  269 2.60% 3.70% 33.83% 59.85% NA
Indica I  595 2.00% 37.80% 5.21% 54.96% NA
Indica II  465 12.50% 48.80% 4.95% 33.76% NA
Indica III  913 3.60% 42.80% 4.49% 49.07% NA
Indica Intermediate  786 3.70% 49.10% 4.45% 42.75% NA
Temperate Japonica  767 99.10% 0.80% 0.00% 0.13% NA
Tropical Japonica  504 97.60% 0.40% 0.20% 1.79% NA
Japonica Intermediate  241 96.70% 1.20% 0.00% 2.07% NA
VI/Aromatic  96 17.70% 2.10% 6.25% 73.96% NA
Intermediate  90 48.90% 18.90% 4.44% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216032860 A -> G LOC_Os02g27240.1 upstream_gene_variant ; 2232.0bp to feature; MODIFIER silent_mutation Average:38.581; most accessible tissue: Minghui63 flower, score: 80.659 N N N N
vg0216032860 A -> G LOC_Os02g27250.1 downstream_gene_variant ; 1784.0bp to feature; MODIFIER silent_mutation Average:38.581; most accessible tissue: Minghui63 flower, score: 80.659 N N N N
vg0216032860 A -> G LOC_Os02g27240-LOC_Os02g27250 intergenic_region ; MODIFIER silent_mutation Average:38.581; most accessible tissue: Minghui63 flower, score: 80.659 N N N N
vg0216032860 A -> DEL N N silent_mutation Average:38.581; most accessible tissue: Minghui63 flower, score: 80.659 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216032860 NA 3.56E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 9.54E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 8.17E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 1.39E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 1.57E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 4.45E-06 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 6.93E-10 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 4.64E-11 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 3.49E-06 8.58E-11 mr1109_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 1.01E-06 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 1.20E-10 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 1.33E-43 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 4.74E-09 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 2.89E-08 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 8.54E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 6.12E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 5.37E-08 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 3.37E-06 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 6.49E-09 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 9.97E-09 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 4.11E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 3.56E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 9.22E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 2.19E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 3.47E-07 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860 NA 7.76E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251