Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216032860:

Variant ID: vg0216032860 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16032860
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTCGGAGAACACCTGAGCTTGTAGAGGGGAGAAAGAGAAAGAGGAAGAGGGTTTCTAGAGCTTGAACTCTCTTACTCTTCAGCTCTTTGTAACTCCTTC[A/G]
TACACAGATCCACCAGAATACAGGAGTAGGGTATTACGCTTCTCAGCGGCCCGAACCTGTCTACATCGCCCGTGTCTTGTGCATTTGCTCTCTCGCGAAA

Reverse complement sequence

TTTCGCGAGAGAGCAAATGCACAAGACACGGGCGATGTAGACAGGTTCGGGCCGCTGAGAAGCGTAATACCCTACTCCTGTATTCTGGTGGATCTGTGTA[T/C]
GAAGGAGTTACAAAGAGCTGAAGAGTAAGAGAGTTCAAGCTCTAGAAACCCTCTTCCTCTTTCTCTTTCTCCCCTCTACAAGCTCAGGTGTTCTCCGAGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.70%	26.90%	4.91%	32.59%	NA
All Indica	2759	4.80%	44.50%	4.71%	45.96%	NA
All Japonica	1512	98.20%	0.70%	0.07%	0.99%	NA
Aus	269	2.60%	3.70%	33.83%	59.85%	NA
Indica I	595	2.00%	37.80%	5.21%	54.96%	NA
Indica II	465	12.50%	48.80%	4.95%	33.76%	NA
Indica III	913	3.60%	42.80%	4.49%	49.07%	NA
Indica Intermediate	786	3.70%	49.10%	4.45%	42.75%	NA
Temperate Japonica	767	99.10%	0.80%	0.00%	0.13%	NA
Tropical Japonica	504	97.60%	0.40%	0.20%	1.79%	NA
Japonica Intermediate	241	96.70%	1.20%	0.00%	2.07%	NA
VI/Aromatic	96	17.70%	2.10%	6.25%	73.96%	NA
Intermediate	90	48.90%	18.90%	4.44%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216032860	A -> G	LOC_Os02g27240.1	upstream_gene_variant ; 2232.0bp to feature; MODIFIER	silent_mutation	Average:38.581; most accessible tissue: Minghui63 flower, score: 80.659	N	N	N	N
vg0216032860	A -> G	LOC_Os02g27250.1	downstream_gene_variant ; 1784.0bp to feature; MODIFIER	silent_mutation	Average:38.581; most accessible tissue: Minghui63 flower, score: 80.659	N	N	N	N
vg0216032860	A -> G	LOC_Os02g27240-LOC_Os02g27250	intergenic_region ; MODIFIER	silent_mutation	Average:38.581; most accessible tissue: Minghui63 flower, score: 80.659	N	N	N	N
vg0216032860	A -> DEL	N	N	silent_mutation	Average:38.581; most accessible tissue: Minghui63 flower, score: 80.659	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216032860	NA	3.56E-10	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	9.54E-09	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	8.17E-07	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	1.39E-06	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	1.57E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	4.45E-06	mr1064_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	6.93E-10	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	4.64E-11	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	3.49E-06	8.58E-11	mr1109_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	1.01E-06	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	1.20E-10	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	1.33E-43	mr1243_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	4.74E-09	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	2.89E-08	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	8.54E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	6.12E-06	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	5.37E-08	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	3.37E-06	mr1577_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	6.49E-09	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	9.97E-09	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	4.11E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	3.56E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	9.22E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	2.19E-07	mr1792_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	3.47E-07	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216032860	NA	7.76E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251