Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216009094:

Variant ID: vg0216009094 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16009094
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CTAATATGTTTGATGGGTGGCTTATGGGGGTTAATAAGAAGAAGTGTAATCTCATACTTGTAGGAACATTTGCCATATGTTAGGCTCTATGGTTGAGTAG[G/A]
AATGATTTAGTTTTTAACAAATCACCATATACTTCATATATGCAGGTAATATTCAAGGTAACATATTGGCTCCAGTTTTGGGCAAAGCTGCAAAAGTGTG

Reverse complement sequence

CACACTTTTGCAGCTTTGCCCAAAACTGGAGCCAATATGTTACCTTGAATATTACCTGCATATATGAAGTATATGGTGATTTGTTAAAAACTAAATCATT[C/T]
CTACTCAACCATAGAGCCTAACATATGGCAAATGTTCCTACAAGTATGAGATTACACTTCTTCTTATTAACCCCCATAAGCCACCCATCAAACATATTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.50% 23.50% 0.97% 0.00% NA
All Indica  2759 96.00% 3.70% 0.25% 0.00% NA
All Japonica  1512 38.60% 58.90% 2.51% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 90.30% 8.80% 0.86% 0.00% NA
Indica III  913 95.50% 4.30% 0.22% 0.00% NA
Indica Intermediate  786 97.50% 2.40% 0.13% 0.00% NA
Temperate Japonica  767 12.10% 85.00% 2.87% 0.00% NA
Tropical Japonica  504 80.60% 18.30% 1.19% 0.00% NA
Japonica Intermediate  241 34.90% 61.00% 4.15% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216009094 G -> A LOC_Os02g27200.1 downstream_gene_variant ; 4061.0bp to feature; MODIFIER silent_mutation Average:77.075; most accessible tissue: Minghui63 root, score: 90.686 N N N N
vg0216009094 G -> A LOC_Os02g27220.1 downstream_gene_variant ; 415.0bp to feature; MODIFIER silent_mutation Average:77.075; most accessible tissue: Minghui63 root, score: 90.686 N N N N
vg0216009094 G -> A LOC_Os02g27210.1 intron_variant ; MODIFIER silent_mutation Average:77.075; most accessible tissue: Minghui63 root, score: 90.686 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0216009094 G A -0.02 -0.01 -0.02 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216009094 9.79E-06 NA Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0216009094 NA 2.59E-28 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 NA 3.32E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 6.13E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 NA 6.00E-34 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 1.22E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 1.46E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 8.03E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 NA 8.76E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 NA 6.94E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 NA 1.72E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 3.54E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 NA 4.30E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216009094 NA 2.78E-14 mr1778_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251