Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0215982412:

Variant ID: vg0215982412 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 15982412
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

TACATCCTTTACTCGCTTTATGGTCTCCGCTTCCGTTATGTGTGCATTTATGTTGTGTCCATTGGGGAGAAGAGAGTGGGTAGTTGGGACGGACGTCGAC[G/A]
GTCAACGTTCCTCTTTTTTCCTTTTGTTGTCCACAGGCCAGAGCATGTATGCTATGGCTGTCCCTGGGCTTTATCTGGTCTCCTCTTTCTTACGCCTTGC

Reverse complement sequence

GCAAGGCGTAAGAAAGAGGAGACCAGATAAAGCCCAGGGACAGCCATAGCATACATGCTCTGGCCTGTGGACAACAAAAGGAAAAAAGAGGAACGTTGAC[C/T]
GTCGACGTCCGTCCCAACTACCCACTCTCTTCTCCCCAATGGACACAACATAAATGCACACATAACGGAAGCGGAGACCATAAAGCGAGTAAAGGATGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.00%	3.70%	2.20%	1.12%	NA
All Indica	2759	97.70%	0.40%	0.80%	1.05%	NA
All Japonica	1512	83.90%	9.70%	5.09%	1.32%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	92.30%	1.50%	3.01%	3.23%	NA
Indica III	913	98.10%	0.20%	0.55%	1.10%	NA
Indica Intermediate	786	98.70%	0.40%	0.38%	0.51%	NA
Temperate Japonica	767	93.20%	2.60%	3.78%	0.39%	NA
Tropical Japonica	504	86.30%	8.10%	3.77%	1.79%	NA
Japonica Intermediate	241	49.00%	35.70%	12.03%	3.32%	NA
VI/Aromatic	96	82.30%	11.50%	3.12%	3.12%	NA
Intermediate	90	93.30%	3.30%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0215982412	G -> A	LOC_Os02g27140.1	upstream_gene_variant ; 2363.0bp to feature; MODIFIER	silent_mutation	Average:21.91; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N
vg0215982412	G -> A	LOC_Os02g27150.1	upstream_gene_variant ; 205.0bp to feature; MODIFIER	silent_mutation	Average:21.91; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N
vg0215982412	G -> A	LOC_Os02g27160.1	downstream_gene_variant ; 4639.0bp to feature; MODIFIER	silent_mutation	Average:21.91; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N
vg0215982412	G -> A	LOC_Os02g27150-LOC_Os02g27160	intergenic_region ; MODIFIER	silent_mutation	Average:21.91; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N
vg0215982412	G -> DEL	N	N	silent_mutation	Average:21.91; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0215982412	2.10E-07	NA	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215982412	9.13E-06	1.61E-10	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215982412	NA	1.20E-06	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215982412	NA	4.64E-11	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215982412	NA	7.64E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215982412	1.49E-09	NA	mr1679_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215982412	5.01E-06	2.30E-09	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215982412	8.36E-07	1.77E-12	mr1691_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215982412	NA	1.23E-06	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215982412	NA	3.71E-06	mr1720_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251