| Variant ID: vg0215951295 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 15951295 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 336. )
GTTATGGACGTGCTGAACTCAGTTGTAGTGCATGCGGATCATGGAAATCTACTAGAACCTCTTGCTGTCCCGCAGACAGCACACCGGGTTTCTCTGTATG[C/T]
GGATGATGTGGTCATGTTCTTGCGTCCTACAAGCGGGGACCTATCTCTTATCAAGCAGATTTTGGAGGTTTTTGGTCAAATTTCTGGACTAAGAACCAAT
ATTGGTTCTTAGTCCAGAAATTTGACCAAAAACCTCCAAAATCTGCTTGATAAGAGATAGGTCCCCGCTTGTAGGACGCAAGAACATGACCACATCATCC[G/A]
CATACAGAGAAACCCGGTGTGCTGTCTGCGGGACAGCAAGAGGTTCTAGTAGATTTCCATGATCCGCATGCACTACAACTGAGTTCAGCACGTCCATAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 6.70% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 83.70% | 15.10% | 1.26% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.00% | 7.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.20% | 5.70% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 85.70% | 13.90% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.00% | 47.30% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0215951295 | C -> T | LOC_Os02g27120.1 | missense_variant ; p.Ala157Val; MODERATE | nonsynonymous_codon ; A157V | Average:64.955; most accessible tissue: Minghui63 flower, score: 76.811 | unknown | unknown | DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0215951295 | NA | 2.21E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215951295 | 4.82E-08 | NA | mr1679 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215951295 | NA | 3.44E-10 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215951295 | NA | 3.31E-06 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215951295 | NA | 6.44E-11 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215951295 | NA | 1.53E-06 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215951295 | 1.04E-07 | NA | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215951295 | NA | 1.56E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215951295 | NA | 1.85E-12 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215951295 | NA | 6.33E-06 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/