| Variant ID: vg0215898350 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 15898350 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )
TTTGTTTGAAAAATCCTTTCGAGTGAGTTTTTCTAAGTGTCGGAGTATCCGATGTTGGATCAGATAGTCCAATGATACAGAGACTCCGAAATTTCATGGA[A/G]
CTTGAGTCTCTGTTGGAGGATGAAGTTTTTGCTTCTAAAATATCGGATACTCCGATTTAACATTAGATTGTCCGATGTCTCGGAAAGTCCGAAATTTCAT
ATGAAATTTCGGACTTTCCGAGACATCGGACAATCTAATGTTAAATCGGAGTATCCGATATTTTAGAAGCAAAAACTTCATCCTCCAACAGAGACTCAAG[T/C]
TCCATGAAATTTCGGAGTCTCTGTATCATTGGACTATCTGATCCAACATCGGATACTCCGACACTTAGAAAAACTCACTCGAAAGGATTTTTCAAACAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 39.90% | 0.23% | 0.02% | NA |
| All Indica | 2759 | 93.40% | 6.20% | 0.36% | 0.04% | NA |
| All Japonica | 1512 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 69.10% | 30.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 87.30% | 12.00% | 0.43% | 0.22% | NA |
| Indica III | 913 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.00% | 5.30% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 56.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0215898350 | A -> G | LOC_Os02g27040.1 | upstream_gene_variant ; 1375.0bp to feature; MODIFIER | silent_mutation | Average:40.741; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0215898350 | A -> G | LOC_Os02g27050.1 | upstream_gene_variant ; 3920.0bp to feature; MODIFIER | silent_mutation | Average:40.741; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0215898350 | A -> G | LOC_Os02g27030.1 | downstream_gene_variant ; 3053.0bp to feature; MODIFIER | silent_mutation | Average:40.741; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0215898350 | A -> G | LOC_Os02g27030-LOC_Os02g27040 | intergenic_region ; MODIFIER | silent_mutation | Average:40.741; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0215898350 | A -> DEL | N | N | silent_mutation | Average:40.741; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0215898350 | NA | 3.25E-12 | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215898350 | NA | 1.69E-09 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215898350 | NA | 3.78E-12 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215898350 | NA | 3.44E-13 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215898350 | NA | 1.07E-08 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215898350 | 5.86E-07 | 1.73E-13 | mr1093 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215898350 | NA | 1.91E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215898350 | NA | 4.74E-10 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215898350 | NA | 9.06E-07 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215898350 | NA | 1.44E-33 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/