Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0215878891:

Variant ID: vg0215878891 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 15878891
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGGCTGTAGATCAATGACAACAGTTGTTGGTGGAGTCGTCGGTGGTGCTTGGCATTGGTGCTAGATGTTGTCAGAGATACGAAGAAGCCCAGGAGGTCA[G/A]
GGTCGCGGCGGTGTGCGCGTCCTGCGTCGAAGCCGAGCCGGCGACGGAGATCAGGGCGATGCCGAGAAGGAGCTGGCTAGGGTTTTAGCTAGGTCGTGCA

Reverse complement sequence

TGCACGACCTAGCTAAAACCCTAGCCAGCTCCTTCTCGGCATCGCCCTGATCTCCGTCGCCGGCTCGGCTTCGACGCAGGACGCGCACACCGCCGCGACC[C/T]
TGACCTCCTGGGCTTCTTCGTATCTCTGACAACATCTAGCACCAATGCCAAGCACCACCGACGACTCCACCAACAACTGTTGTCATTGATCTACAGCCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.60%	0.10%	0.08%	1.16%	NA
All Indica	2759	99.90%	0.00%	0.00%	0.07%	NA
All Japonica	1512	96.70%	0.10%	0.07%	3.11%	NA
Aus	269	98.10%	0.70%	1.12%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.00%	0.13%	NA
Temperate Japonica	767	98.20%	0.10%	0.13%	1.56%	NA
Tropical Japonica	504	98.40%	0.00%	0.00%	1.59%	NA
Japonica Intermediate	241	88.40%	0.40%	0.00%	11.20%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	98.90%	0.00%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0215878891	G -> A	LOC_Os02g27010.1	upstream_gene_variant ; 960.0bp to feature; MODIFIER	silent_mutation	Average:61.946; most accessible tissue: Minghui63 young leaf, score: 78.054	N	N	N	N
vg0215878891	G -> A	LOC_Os02g27000.1	downstream_gene_variant ; 2402.0bp to feature; MODIFIER	silent_mutation	Average:61.946; most accessible tissue: Minghui63 young leaf, score: 78.054	N	N	N	N
vg0215878891	G -> A	LOC_Os02g27020.1	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:61.946; most accessible tissue: Minghui63 young leaf, score: 78.054	N	N	N	N
vg0215878891	G -> A	LOC_Os02g27000-LOC_Os02g27010	intergenic_region ; MODIFIER	silent_mutation	Average:61.946; most accessible tissue: Minghui63 young leaf, score: 78.054	N	N	N	N
vg0215878891	G -> DEL	N	N	silent_mutation	Average:61.946; most accessible tissue: Minghui63 young leaf, score: 78.054	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0215878891	3.74E-06	4.78E-07	mr1129_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215878891	NA	1.37E-06	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215878891	NA	6.45E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251