\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0215745955:

Variant ID: vg0215745955 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 15745955
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:


TTTACTCTTCTGTGCATTACCTCTGCAATATTACCCCCTGCCACACTGCATAGTAAGCCAAGCACCTGCTAATATGTTTGACCTCACAACAATCTATTCG[C/T]
TGCTAATAATGTACCTATTTGATATCCAAGAAACAATAACTACTAAATAATATCGTATGCAGAGATAAATCAAAATCAGTAGATTATTACTTGTTTGGTG

Reverse complement sequence

CACCAAACAAGTAATAATCTACTGATTTTGATTTATCTCTGCATACGATATTATTTAGTAGTTATTGTTTCTTGGATATCAAATAGGTACATTATTAGCA[G/A]
CGAATAGATTGTTGTGAGGTCAAACATATTAGCAGGTGCTTGGCTTACTATGCAGTGTGGCAGGGGGTAATATTGCAGAGGTAATGCACAGAAGAGTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 6.80% 2.96% 0.00% NA
All Indica  2759 83.70% 11.40% 4.89% 0.00% NA
All Japonica  1512 99.70% 0.10% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.30% 0.00% 7.73% 0.00% NA
Indica II  465 66.90% 24.30% 8.82% 0.00% NA
Indica III  913 83.10% 15.40% 1.42% 0.00% NA
Indica Intermediate  786 87.80% 7.80% 4.45% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 4.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0215745955 C -> T LOC_Os02g26820.1 upstream_gene_variant ; 1894.0bp to feature; MODIFIER silent_mutation Average:74.212; most accessible tissue: Callus, score: 86.421 N N N N
vg0215745955 C -> T LOC_Os02g26814.1 downstream_gene_variant ; 2981.0bp to feature; MODIFIER silent_mutation Average:74.212; most accessible tissue: Callus, score: 86.421 N N N N
vg0215745955 C -> T LOC_Os02g26830.1 downstream_gene_variant ; 3424.0bp to feature; MODIFIER silent_mutation Average:74.212; most accessible tissue: Callus, score: 86.421 N N N N
vg0215745955 C -> T LOC_Os02g26814.2 downstream_gene_variant ; 2981.0bp to feature; MODIFIER silent_mutation Average:74.212; most accessible tissue: Callus, score: 86.421 N N N N
vg0215745955 C -> T LOC_Os02g26814.3 downstream_gene_variant ; 2981.0bp to feature; MODIFIER silent_mutation Average:74.212; most accessible tissue: Callus, score: 86.421 N N N N
vg0215745955 C -> T LOC_Os02g26814.4 downstream_gene_variant ; 2981.0bp to feature; MODIFIER silent_mutation Average:74.212; most accessible tissue: Callus, score: 86.421 N N N N
vg0215745955 C -> T LOC_Os02g26814.5 downstream_gene_variant ; 2979.0bp to feature; MODIFIER silent_mutation Average:74.212; most accessible tissue: Callus, score: 86.421 N N N N
vg0215745955 C -> T LOC_Os02g26814-LOC_Os02g26820 intergenic_region ; MODIFIER silent_mutation Average:74.212; most accessible tissue: Callus, score: 86.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0215745955 NA 1.11E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 1.22E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 3.12E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 2.81E-06 2.38E-08 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 9.74E-09 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 1.02E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 7.98E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 4.07E-09 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 4.76E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 4.97E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 5.19E-09 8.90E-19 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 4.69E-08 1.56E-18 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 1.45E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 3.59E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 3.05E-07 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 1.06E-08 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 4.47E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 4.75E-06 NA mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 4.40E-08 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 1.57E-06 NA mr1317_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 6.19E-06 1.78E-11 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 2.00E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 4.19E-06 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 2.05E-07 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 1.71E-09 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 6.31E-09 4.95E-15 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 8.51E-07 NA mr1897_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 2.16E-09 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 4.77E-07 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 1.65E-06 1.02E-11 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215745955 NA 6.39E-08 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251