\
| Variant ID: vg0215720831 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 15720831 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACCTCCCCCCCCCCCCTCTCTTCCCTAAGGCGACGACGGTAGCAAGTGCCCCCCACCATCTTCTTCGTGTCCTGTGACTCCCCTCCACCACCACCGGTC[G/A]
CCACCGCCTAACCACAAGCTCTGTTTGGCCCTCGCAACCAACGTCGGCCCGCTGCCATCTCCTCCAACACCTTGGCTCCAACACTGGAGTCCTATCCATG
CATGGATAGGACTCCAGTGTTGGAGCCAAGGTGTTGGAGGAGATGGCAGCGGGCCGACGTTGGTTGCGAGGGCCAAACAGAGCTTGTGGTTAGGCGGTGG[C/T]
GACCGGTGGTGGTGGAGGGGAGTCACAGGACACGAAGAAGATGGTGGGGGGCACTTGCTACCGTCGTCGCCTTAGGGAAGAGAGGGGGGGGGGGGAGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 11.70% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 64.40% | 34.70% | 0.93% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.10% | 5.30% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 16.90% | 81.70% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 29.90% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0215720831 | G -> A | LOC_Os02g26770.1 | upstream_gene_variant ; 1974.0bp to feature; MODIFIER | silent_mutation | Average:74.065; most accessible tissue: Zhenshan97 young leaf, score: 93.028 | N | N | N | N |
| vg0215720831 | G -> A | LOC_Os02g26780.1 | upstream_gene_variant ; 2352.0bp to feature; MODIFIER | silent_mutation | Average:74.065; most accessible tissue: Zhenshan97 young leaf, score: 93.028 | N | N | N | N |
| vg0215720831 | G -> A | LOC_Os02g26760.1 | downstream_gene_variant ; 4396.0bp to feature; MODIFIER | silent_mutation | Average:74.065; most accessible tissue: Zhenshan97 young leaf, score: 93.028 | N | N | N | N |
| vg0215720831 | G -> A | LOC_Os02g26790.1 | downstream_gene_variant ; 4850.0bp to feature; MODIFIER | silent_mutation | Average:74.065; most accessible tissue: Zhenshan97 young leaf, score: 93.028 | N | N | N | N |
| vg0215720831 | G -> A | LOC_Os02g26770-LOC_Os02g26780 | intergenic_region ; MODIFIER | silent_mutation | Average:74.065; most accessible tissue: Zhenshan97 young leaf, score: 93.028 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0215720831 | NA | 2.63E-09 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 2.69E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 1.50E-09 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 1.50E-09 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 9.70E-11 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 1.68E-10 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 7.17E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 5.85E-19 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 4.08E-07 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 1.35E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 3.65E-09 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 1.31E-09 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 2.66E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 4.58E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 3.48E-35 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | 1.75E-06 | 4.11E-13 | mr1769 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 2.05E-19 | mr1769 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 9.05E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 1.77E-11 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 2.65E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 2.65E-10 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 4.78E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 1.07E-07 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 1.66E-19 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 5.62E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 5.46E-37 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 3.53E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | 1.16E-07 | 2.16E-14 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 3.37E-16 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 1.08E-20 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215720831 | NA | 2.41E-09 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |