\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0215683252:

Variant ID: vg0215683252 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 15683252
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


AATGATAAGGTTGGAGGGAAGATGCCTTATAAGTTGGTTCCAACCTTGCTAAACTAGCAAGGTGGTACTAAACATGCCCACACAGCTCTCATGGGCCACA[C/T,A]
AGACCTCATCCTAATTGGCCCAGGATGTCACACAAGGCGACAGGGTGGTGACCGGATCCGGCAATGCTAGCCATCGGAGATGGAGAAGGCTCAGTAGCAT

Reverse complement sequence

ATGCTACTGAGCCTTCTCCATCTCCGATGGCTAGCATTGCCGGATCCGGTCACCACCCTGTCGCCTTGTGTGACATCCTGGGCCAATTAGGATGAGGTCT[G/A,T]
TGTGGCCCATGAGAGCTGTGTGGGCATGTTTAGTACCACCTTGCTAGTTTAGCAAGGTTGGAACCAACTTATAAGGCATCTTCCCTCCAACCTTATCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 5.40% 1.54% 0.00% NA
All Indica  2759 88.50% 9.00% 2.50% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 0.00% 2.18% 0.00% NA
Indica II  465 72.30% 20.40% 7.31% 0.00% NA
Indica III  913 88.20% 11.10% 0.77% 0.00% NA
Indica Intermediate  786 91.50% 6.60% 1.91% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 3.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0215683252 C -> A LOC_Os02g26700.1 upstream_gene_variant ; 3563.0bp to feature; MODIFIER N Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> A LOC_Os02g26700.2 upstream_gene_variant ; 3684.0bp to feature; MODIFIER N Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> A LOC_Os02g26700.3 upstream_gene_variant ; 3684.0bp to feature; MODIFIER N Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> A LOC_Os02g26700.4 upstream_gene_variant ; 3684.0bp to feature; MODIFIER N Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> A LOC_Os02g26700.6 upstream_gene_variant ; 3684.0bp to feature; MODIFIER N Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> A LOC_Os02g26700.7 upstream_gene_variant ; 3684.0bp to feature; MODIFIER N Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> A LOC_Os02g26700.9 upstream_gene_variant ; 3684.0bp to feature; MODIFIER N Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> A LOC_Os02g26700.8 upstream_gene_variant ; 3684.0bp to feature; MODIFIER N Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> A LOC_Os02g26700-LOC_Os02g26710 intergenic_region ; MODIFIER N Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> T LOC_Os02g26700.1 upstream_gene_variant ; 3563.0bp to feature; MODIFIER silent_mutation Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> T LOC_Os02g26700.2 upstream_gene_variant ; 3684.0bp to feature; MODIFIER silent_mutation Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> T LOC_Os02g26700.3 upstream_gene_variant ; 3684.0bp to feature; MODIFIER silent_mutation Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> T LOC_Os02g26700.4 upstream_gene_variant ; 3684.0bp to feature; MODIFIER silent_mutation Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> T LOC_Os02g26700.6 upstream_gene_variant ; 3684.0bp to feature; MODIFIER silent_mutation Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> T LOC_Os02g26700.7 upstream_gene_variant ; 3684.0bp to feature; MODIFIER silent_mutation Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> T LOC_Os02g26700.9 upstream_gene_variant ; 3684.0bp to feature; MODIFIER silent_mutation Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> T LOC_Os02g26700.8 upstream_gene_variant ; 3684.0bp to feature; MODIFIER silent_mutation Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0215683252 C -> T LOC_Os02g26700-LOC_Os02g26710 intergenic_region ; MODIFIER silent_mutation Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0215683252 NA 1.97E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 2.44E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 2.04E-06 2.67E-08 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 5.56E-08 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 9.59E-07 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 8.37E-16 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 2.10E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 2.92E-08 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 1.96E-06 NA mr1253_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 4.33E-09 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 6.98E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 6.68E-11 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 7.10E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 7.07E-07 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 7.26E-07 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 5.29E-06 9.66E-13 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 7.72E-06 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 6.62E-09 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 1.19E-06 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 3.13E-06 4.81E-11 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215683252 NA 8.74E-07 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251