\
| Variant ID: vg0215683252 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 15683252 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )
AATGATAAGGTTGGAGGGAAGATGCCTTATAAGTTGGTTCCAACCTTGCTAAACTAGCAAGGTGGTACTAAACATGCCCACACAGCTCTCATGGGCCACA[C/T,A]
AGACCTCATCCTAATTGGCCCAGGATGTCACACAAGGCGACAGGGTGGTGACCGGATCCGGCAATGCTAGCCATCGGAGATGGAGAAGGCTCAGTAGCAT
ATGCTACTGAGCCTTCTCCATCTCCGATGGCTAGCATTGCCGGATCCGGTCACCACCCTGTCGCCTTGTGTGACATCCTGGGCCAATTAGGATGAGGTCT[G/A,T]
TGTGGCCCATGAGAGCTGTGTGGGCATGTTTAGTACCACCTTGCTAGTTTAGCAAGGTTGGAACCAACTTATAAGGCATCTTCCCTCCAACCTTATCATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 5.40% | 1.54% | 0.00% | NA |
| All Indica | 2759 | 88.50% | 9.00% | 2.50% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 0.00% | 2.18% | 0.00% | NA |
| Indica II | 465 | 72.30% | 20.40% | 7.31% | 0.00% | NA |
| Indica III | 913 | 88.20% | 11.10% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 91.50% | 6.60% | 1.91% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 3.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0215683252 | C -> A | LOC_Os02g26700.1 | upstream_gene_variant ; 3563.0bp to feature; MODIFIER | N | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> A | LOC_Os02g26700.2 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | N | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> A | LOC_Os02g26700.3 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | N | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> A | LOC_Os02g26700.4 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | N | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> A | LOC_Os02g26700.6 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | N | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> A | LOC_Os02g26700.7 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | N | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> A | LOC_Os02g26700.9 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | N | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> A | LOC_Os02g26700.8 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | N | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> A | LOC_Os02g26700-LOC_Os02g26710 | intergenic_region ; MODIFIER | N | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> T | LOC_Os02g26700.1 | upstream_gene_variant ; 3563.0bp to feature; MODIFIER | silent_mutation | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> T | LOC_Os02g26700.2 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | silent_mutation | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> T | LOC_Os02g26700.3 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | silent_mutation | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> T | LOC_Os02g26700.4 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | silent_mutation | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> T | LOC_Os02g26700.6 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | silent_mutation | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> T | LOC_Os02g26700.7 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | silent_mutation | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> T | LOC_Os02g26700.9 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | silent_mutation | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> T | LOC_Os02g26700.8 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | silent_mutation | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0215683252 | C -> T | LOC_Os02g26700-LOC_Os02g26710 | intergenic_region ; MODIFIER | silent_mutation | Average:67.511; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0215683252 | NA | 1.97E-07 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | 2.44E-06 | NA | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | 2.04E-06 | 2.67E-08 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 5.56E-08 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 9.59E-07 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 8.37E-16 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 2.10E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 2.92E-08 | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | 1.96E-06 | NA | mr1253_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 4.33E-09 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 6.98E-06 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 6.68E-11 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 7.10E-06 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 7.07E-07 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | 7.26E-07 | NA | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | 5.29E-06 | 9.66E-13 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | 7.72E-06 | NA | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 6.62E-09 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | 1.19E-06 | NA | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | 3.13E-06 | 4.81E-11 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215683252 | NA | 8.74E-07 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |