\
| Variant ID: vg0215574189 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 15574189 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )
GCTAAAACCGATGTCCAAACCGTTATGGGACCTATATTGCATCGGTTTTGGTAGTTGAAGGACACGCTGTATCTGGTTTTCCGGTTGAAGGACGAAAGTC[G/A]
GATTTGTTGATAAGTTAAGGGACCTCAAGTGAATGTATTCCTTATTCAGCAGATTGCCGCTGCACAAAAGGAATAAGTTCACTTTGACTCCCTTAAAAGT
ACTTTTAAGGGAGTCAAAGTGAACTTATTCCTTTTGTGCAGCGGCAATCTGCTGAATAAGGAATACATTCACTTGAGGTCCCTTAACTTATCAACAAATC[C/T]
GACTTTCGTCCTTCAACCGGAAAACCAGATACAGCGTGTCCTTCAACTACCAAAACCGATGCAATATAGGTCCCATAACGGTTTGGACATCGGTTTTAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.20% | 6.70% | 1.08% | 0.00% | NA |
| All Indica | 2759 | 87.00% | 11.20% | 1.74% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 71.40% | 24.10% | 4.52% | 0.00% | NA |
| Indica III | 913 | 83.40% | 15.90% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 91.10% | 6.70% | 2.16% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0215574189 | G -> A | LOC_Os02g26520.1 | upstream_gene_variant ; 782.0bp to feature; MODIFIER | silent_mutation | Average:48.735; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0215574189 | G -> A | LOC_Os02g26530.1 | upstream_gene_variant ; 346.0bp to feature; MODIFIER | silent_mutation | Average:48.735; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0215574189 | G -> A | LOC_Os02g26540.1 | downstream_gene_variant ; 2952.0bp to feature; MODIFIER | silent_mutation | Average:48.735; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0215574189 | G -> A | LOC_Os02g26520-LOC_Os02g26530 | intergenic_region ; MODIFIER | silent_mutation | Average:48.735; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0215574189 | NA | 1.22E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | NA | 6.77E-08 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | NA | 5.03E-07 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | NA | 9.35E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | 1.82E-06 | NA | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | NA | 8.30E-15 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | NA | 6.65E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | NA | 9.44E-09 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | 2.41E-08 | NA | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | 4.59E-07 | 5.21E-13 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | NA | 1.39E-06 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | 3.27E-07 | NA | mr1914_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | 1.53E-06 | 1.37E-10 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0215574189 | NA | 1.60E-06 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |