Variant ID: vg0215099729 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 15099729 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATGTGAAGTATACACCGATCACAAAAGTCTTAAGTACATCTTCACCCAGACCGAGTTAAATATGAGGCAGAGAAGATGGTTGGAACTAATCAAGGATTA[C/T]
GATCTTGGAATTCATTACCATCCCGGTAAAGCTAATGTGGTCGCTGATGCGCTAAGTCGCAAGACCTACTACAATGTAGCTCAAATATGGCCAGACCAAG
CTTGGTCTGGCCATATTTGAGCTACATTGTAGTAGGTCTTGCGACTTAGCGCATCAGCGACCACATTAGCTTTACCGGGATGGTAATGAATTCCAAGATC[G/A]
TAATCCTTGATTAGTTCCAACCATCTTCTCTGCCTCATATTTAACTCGGTCTGGGTGAAGATGTACTTAAGACTTTTGTGATCGGTGTATACTTCACATC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 82.00% | 0.10% | 3.53% | 14.35% | NA |
All Indica | 2759 | 71.00% | 0.10% | 5.76% | 23.16% | NA |
All Japonica | 1512 | 98.80% | 0.10% | 0.07% | 0.99% | NA |
Aus | 269 | 94.40% | 0.00% | 2.23% | 3.35% | NA |
Indica I | 595 | 69.20% | 0.00% | 11.43% | 19.33% | NA |
Indica II | 465 | 66.90% | 0.20% | 5.16% | 27.74% | NA |
Indica III | 913 | 73.80% | 0.00% | 1.97% | 24.21% | NA |
Indica Intermediate | 786 | 71.40% | 0.30% | 6.23% | 22.14% | NA |
Temperate Japonica | 767 | 99.20% | 0.00% | 0.00% | 0.78% | NA |
Tropical Japonica | 504 | 98.20% | 0.20% | 0.00% | 1.59% | NA |
Japonica Intermediate | 241 | 98.80% | 0.40% | 0.41% | 0.41% | NA |
VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
Intermediate | 90 | 83.30% | 0.00% | 1.11% | 15.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0215099729 | C -> T | LOC_Os02g25770.1 | synonymous_variant ; p.Tyr1063Tyr; LOW | synonymous_codon | Average:11.402; most accessible tissue: Callus, score: 20.395 | N | N | N | N |
vg0215099729 | C -> DEL | LOC_Os02g25770.1 | N | frameshift_variant | Average:11.402; most accessible tissue: Callus, score: 20.395 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0215099729 | 1.61E-07 | NA | mr1003 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0215099729 | 2.38E-06 | 1.30E-06 | mr1003 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0215099729 | 9.93E-09 | 6.03E-07 | mr1004 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0215099729 | 2.48E-06 | 3.31E-07 | mr1004 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0215099729 | 5.33E-07 | NA | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0215099729 | 7.21E-06 | NA | mr1005 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0215099729 | 6.00E-06 | 1.01E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0215099729 | 3.96E-06 | 3.95E-06 | mr1012 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0215099729 | 7.97E-07 | NA | mr1051 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0215099729 | 4.80E-06 | 4.36E-06 | mr1051 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |