Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0215099729:

Variant ID: vg0215099729 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 15099729
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGTGAAGTATACACCGATCACAAAAGTCTTAAGTACATCTTCACCCAGACCGAGTTAAATATGAGGCAGAGAAGATGGTTGGAACTAATCAAGGATTA[C/T]
GATCTTGGAATTCATTACCATCCCGGTAAAGCTAATGTGGTCGCTGATGCGCTAAGTCGCAAGACCTACTACAATGTAGCTCAAATATGGCCAGACCAAG

Reverse complement sequence

CTTGGTCTGGCCATATTTGAGCTACATTGTAGTAGGTCTTGCGACTTAGCGCATCAGCGACCACATTAGCTTTACCGGGATGGTAATGAATTCCAAGATC[G/A]
TAATCCTTGATTAGTTCCAACCATCTTCTCTGCCTCATATTTAACTCGGTCTGGGTGAAGATGTACTTAAGACTTTTGTGATCGGTGTATACTTCACATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.00% 0.10% 3.53% 14.35% NA
All Indica  2759 71.00% 0.10% 5.76% 23.16% NA
All Japonica  1512 98.80% 0.10% 0.07% 0.99% NA
Aus  269 94.40% 0.00% 2.23% 3.35% NA
Indica I  595 69.20% 0.00% 11.43% 19.33% NA
Indica II  465 66.90% 0.20% 5.16% 27.74% NA
Indica III  913 73.80% 0.00% 1.97% 24.21% NA
Indica Intermediate  786 71.40% 0.30% 6.23% 22.14% NA
Temperate Japonica  767 99.20% 0.00% 0.00% 0.78% NA
Tropical Japonica  504 98.20% 0.20% 0.00% 1.59% NA
Japonica Intermediate  241 98.80% 0.40% 0.41% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 83.30% 0.00% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0215099729 C -> T LOC_Os02g25770.1 synonymous_variant ; p.Tyr1063Tyr; LOW synonymous_codon Average:11.402; most accessible tissue: Callus, score: 20.395 N N N N
vg0215099729 C -> DEL LOC_Os02g25770.1 N frameshift_variant Average:11.402; most accessible tissue: Callus, score: 20.395 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0215099729 1.61E-07 NA mr1003 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215099729 2.38E-06 1.30E-06 mr1003 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215099729 9.93E-09 6.03E-07 mr1004 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215099729 2.48E-06 3.31E-07 mr1004 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215099729 5.33E-07 NA mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215099729 7.21E-06 NA mr1005 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215099729 6.00E-06 1.01E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215099729 3.96E-06 3.95E-06 mr1012 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215099729 7.97E-07 NA mr1051 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215099729 4.80E-06 4.36E-06 mr1051 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251