Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214942349:

Variant ID: vg0214942349 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 14942349
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCGGGGACCCGACGGGCCCTTTTCATCGAGACAGCAGCGGAGGCAAGTGAGGATGGAGGCACAAGGCGACAGGGCAGACGTGGGATGGAAGATGTCGT[A/T]
CTTTCACCGGTCGATGGGAGACAGCGGTTGCGTCGATTTGGCGAGGAGCCGCCTAGCGGCTGTCTATTTTTGGCCGAATGTCGCGAAAGAGAAGAAACGG

Reverse complement sequence

CCGTTTCTTCTCTTTCGCGACATTCGGCCAAAAATAGACAGCCGCTAGGCGGCTCCTCGCCAAATCGACGCAACCGCTGTCTCCCATCGACCGGTGAAAG[T/A]
ACGACATCTTCCATCCCACGTCTGCCCTGTCGCCTTGTGCCTCCATCCTCACTTGCCTCCGCTGCTGTCTCGATGAAAAGGGCCCGTCGGGTCCCCGACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.80% 6.30% 7.91% 0.00% NA
All Indica  2759 77.10% 10.60% 12.29% 0.00% NA
All Japonica  1512 99.50% 0.10% 0.33% 0.00% NA
Aus  269 94.10% 0.00% 5.95% 0.00% NA
Indica I  595 75.10% 0.00% 24.87% 0.00% NA
Indica II  465 67.30% 20.90% 11.83% 0.00% NA
Indica III  913 80.60% 16.20% 3.18% 0.00% NA
Indica Intermediate  786 80.40% 6.00% 13.61% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.40% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 83.30% 2.20% 14.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214942349 A -> T LOC_Os02g25580.1 downstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:98.233; most accessible tissue: Minghui63 young leaf, score: 99.695 N N N N
vg0214942349 A -> T LOC_Os02g25580.2 downstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:98.233; most accessible tissue: Minghui63 young leaf, score: 99.695 N N N N
vg0214942349 A -> T LOC_Os02g25560-LOC_Os02g25580 intergenic_region ; MODIFIER silent_mutation Average:98.233; most accessible tissue: Minghui63 young leaf, score: 99.695 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0214942349 A T -0.11 -0.03 -0.02 -0.11 -0.07 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214942349 NA 9.34E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214942349 NA 3.59E-11 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214942349 3.99E-06 1.98E-08 mr1050_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214942349 NA 3.96E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214942349 NA 5.83E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214942349 NA 1.61E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214942349 5.66E-06 6.02E-11 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214942349 NA 2.00E-07 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251