Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214797114:

Variant ID: vg0214797114 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 14797114
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


CATCCATTGCAGATCCATCTACATGAAATGAAAAAACATCGTACATAAATAAATTTTCGTACAATAATGACAGTCAAACAGTAATGATAACATAATTAAA[A/C]
ACTCTTTCGACAAGCAATTCTTATTAACAATTTTTGAAGTTCTAAACTAATATTTATGTTGTACTTCTCTTAATTTTAAATTTAGTTTGTTTTCTATTTT

Reverse complement sequence

AAAATAGAAAACAAACTAAATTTAAAATTAAGAGAAGTACAACATAAATATTAGTTTAGAACTTCAAAAATTGTTAATAAGAATTGCTTGTCGAAAGAGT[T/G]
TTTAATTATGTTATCATTACTGTTTGACTGTCATTATTGTACGAAAATTTATTTATGTACGATGTTTTTTCATTTCATGTAGATGGATCTGCAATGGATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 7.00% 4.23% 0.00% NA
All Indica  2759 81.80% 11.20% 7.00% 0.00% NA
All Japonica  1512 99.30% 0.50% 0.20% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 74.50% 10.90% 14.62% 0.00% NA
Indica II  465 61.50% 28.80% 9.68% 0.00% NA
Indica III  913 99.80% 0.00% 0.22% 0.00% NA
Indica Intermediate  786 78.40% 14.10% 7.51% 0.00% NA
Temperate Japonica  767 99.10% 0.70% 0.26% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214797114 A -> C LOC_Os02g25380.1 upstream_gene_variant ; 319.0bp to feature; MODIFIER silent_mutation Average:21.38; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0214797114 A -> C LOC_Os02g25380-LOC_Os02g25390 intergenic_region ; MODIFIER silent_mutation Average:21.38; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214797114 NA 1.37E-08 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 1.43E-08 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 3.00E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 1.42E-07 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 5.81E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 1.17E-07 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 6.24E-08 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 1.39E-06 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 5.26E-07 2.41E-08 mr1901 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 5.29E-06 3.24E-09 mr1901 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 5.35E-06 NA mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 1.37E-12 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 7.05E-11 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 9.62E-11 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 4.13E-10 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 4.49E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 3.94E-08 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 9.93E-13 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 4.63E-09 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 5.29E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 4.36E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214797114 NA 5.73E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251